Intelligent Design, the best explanation of Origins

This is my personal virtual library, where i collect information, which leads in my view to Intelligent Design as the best explanation of the origin of the physical Universe, life, and biodiversity


You are not connected. Please login or register

Intelligent Design, the best explanation of Origins » Intelligent Design » Information Theory, Coded Information in the cell » Origin of  translation of the 4 nucleic acid bases and the 20 amino acids, and the universal assignment of codons to amino acids

Origin of  translation of the 4 nucleic acid bases and the 20 amino acids, and the universal assignment of codons to amino acids

View previous topic View next topic Go down  Message [Page 1 of 1]

Admin


Admin
Origin of  translation of the 4 nucleic acid bases and the 20 amino acids, and the universal assignment of codons to amino acids

http://reasonandscience.heavenforum.org/t2057-origin-of-translation-of-the-4-nucleic-acid-bases-and-the-20-amino-acids-and-the-universal-assignment-of-codons-to-amino-acids

What must be explained, is  the arrangement of the codons in the standard codon table which is highly non-random, and serves to translate into the amino acid sequence to make proteins, and the origin of the assignment of the 64 triplet codons to the 20 amino acids. That is, the origin of its translation. The origin of a alphabet through the triplet codons is one thing, but on top, it has to be translated to a other " alphabet " constituted through the 20 amino acid sequence. That is, as to explain the origin of capability to translate the english language into chinese.  On top of that, the machinery itself to promote the process itself has also to be explained, that is the hardware. When humans translate english to chinese, for example, we recognise the english word, and the translator knows the equivalent chinese symbol and writes it down. 

In the cell,  Aminoacyl tRNA synthetase recognise the triplet anticodon of the tRNA, and attach the equivalent amino acid to the tRNA. How could random chemical reactions have produced this recognition ? Lets suppose rather than intelligence, chance were the mechanism. The imaginary cell would have to select randomly any of the amino acids, restrict by a unknown mechanism to the 20 used for life, since there are more out there, select by a unknown mechanism only left handed ones, and make a test drive and produce a polynucleotide and see what happens. Some theories try to explain the mechanism, but they all remain unsatisfactory. Obviously. Furthermore, Aminoacyl tRNA synthetase are complex enzymes. For what reason would they have come to be, if the final function could only be employd after the whole translation process was set in place, with a fully functional ribosome being able to do its job? Remembering  the catch22 situation, since they are by themself made through the very own process in question ? 
 Why is it not rational to conclude that the code itself, the software, as well as the hardware, are best explained through the invention of a highly intelligent being, rather than random chemical affinities and reactions? Questions: what good would the ribosome be for without tRNA's ? without amino acids, which are the product of enormously complex chemical processes and pathways ? What good would the machinery be good for, if the code was not established, and neither the assignment of each codon to the respective amino acid ? had the software and the hardware not have to be in place at the same time? Were all the parts not only fully functional if fully developed, interlocked, set-up, and tuned to do its job with precision like a human made motor ? 

And even it lets say, the whole thing was fully working and in place, what good would it be for without all the other parts required, that is, the DNA double helix, its compactation through histones and chromatins and chromosomes, its highly complex mechanism of information extraction and transcription into mRNA?  Had the whole process , that is   INITIATION OF TRANSCRIPTION, CAPPING,  ELONGATION,  SPLICING, CLEAVAGE,POLYADENYLATION AND TERMINATION, EXPORT FROM THE NUCLEUS TO THE CYTOSOL, INITIATION OF PROTEIN SYNTHESIS (TRANSLATION), COMPLETION OF PROTEIN SYNTHESIS AND PROTEIN FOLDING, and its respective machinery not have to be all in place ? Does that not constitute a interdependent, and irreducible complex system ?
 
http://web.archive.org/web/20131209121838/http://gencodesignal.org/faq/
The confusion comes from the ambiguity in using the term “genetic code”. Here is a quote from Francis Crick, who seems to be the one who coined this term:
Unfortunately the phrase “genetic code” is now used in two quite distinct ways. Laymen often use it to mean the entire genetic message in an organism. Molecular biologists usually mean the little dictionary that shows how to relate the four-letter language of the nucleic acids to the twenty-letter language of the proteins, just as the Morse code relates the language of dots and dashes to the twenty-six letters of the alphabet… The proper technical term for such a translation is, strictly speaking, not a code but a cipher. In the same way the Morse code should really be called the Morse cipher. I did not know this at the time, which was fortunate because “genetic code” sounds a lot more intriguing than “genetic cipher” (from “What Mad Pursuit”, 1988)

Transfer RNA, Delivery Vehicle for Amino Acids 11

While the mRNA is being processed by the ribosome in order to assemble amino acids into a protein, how will these amino acids actually be brought into the proper order?  There does not seem to be any innate attraction or affinity between an amino acid and the RNA letters which code for it. In the early research after the Watson-Crick breakthrough, it became apparent that there must be intermediates to bring the amino acids to the ribosome in proper order.  Two such vital go-betweens were finally located.  One serves as a transport molecule.  It is called transfer-RNA, which is a different form of RNA from that which has been described.  Transfer-RNA, written tRNA, is a comparatively short chain of RNA containing some seventy-five or eighty ribonucleotides.

The RNA strand doubles back on itself, and base-pairs with its own chain in some places.  The overall shape of the tRNA molecule in some ways resembles a key or a cloverleaf.  If tRNA is to do its job properly, the shape must be very precise, and this seems to depend in part upon the right temperature and the correct concentration of certain ions (e.g., magnesium and sodium) in the cell fluid. Transfer-RNA is perfectly fitted for its mission.  First of all, each tRNA type attaches to only one variety of the twenty amino acids.  Secondly, the particular tRNA delivers that amino acid in the proper sequence for the forming protein.  This is possible because the tRNA molecule has at one end a special RNA triplet of code letters which match the mRNA codon which specifies that particular amino acid.  When these complementary codons come together by base-pairing, the amino acid being transported by that tRNA is thus in position to be linked to the growing protein chain in the correct order.  All this takes place at the ribosome, which is like a mobile assembly machine as it moves along the mRNA strand (or as the mRNA tape passes through the ribosomes).

https://www.youtube.com/watch?v=D5vH4Q_tAkY


https://vimeo.com/114101147


The cell converts the information carried in an mRNA molecule into a protein molecule. This feat of translation was a focus of attention of biologists in the late 1950s, when it was posed as the “coding problem”: how is the information in a linear sequence of nucleotides in RNA translated into the linear sequence of a chemically quite different set of units—the amino acids in proteins?

The first scientist after Watson and Crick to find a solution of the coding problem, that is the relationship between the DNA structure and protein synthesis was Russian  physicist George Gamow. Gamow published  in the October 1953 issue of Nature  a solution called the “diamond code”, an overlapping triplet code based on a combinatorial scheme in which 4 nucleotides arranged 3-at-a-time would specify 20 amino acids.  Somewhat like a language, this highly restrictive code was primarily hypothetical, based on then-current knowledge of the behavior of nucleic acids and proteins. 3

The concept of coding applied to genetic specificity was somewhat misleading, as translation between the four nucleic acid bases and the 20 amino acids would obey the rules of a cipher instead of a code. As Crick acknowledged years later, in linguistic analysis, ciphers generally operate on units of regular length (as in the triplet DNA scheme), whereas codes operate on units of variable length (e.g., words, phrases). But the code metaphor worked well, even though it was literally inaccurate, and in Crick’s words, “‘Genetic code’ sounds a lot more intriguing than ‘genetic cipher’.”

An mRNA Sequence Is decoded in sets of three nucleotides

Once an mRNA has been produced by transcription and processing, the information present in its nucleotide sequence is used to synthesize a protein. Transcription is simple to understand as a means of information transfer: since DNA and RNA are chemically and structurally similar, the DNA can act as a direct template for the synthesis of RNA by complementary base-pairing. As the term transcription signifies, it is as if a message written out by hand is being converted, say, into a typewritten text. The language itself and the form of the message do not change, and the symbols used are closely related.

In contrast, the conversion of the information in RNA into protein represents a translation of the information into another language that uses quite different symbols. Moreover, since there are only 4 different nucleotides in mRNA and 20 different types of amino acids in a protein, this translation cannot be accounted for by a direct one-to-one correspondence between a nucleotide in RNA and an amino acid in protein. The nucleotide sequence of a gene, through the intermediary of mRNA, is translated into the amino acid sequence of a protein. This code was deciphered in the early 1960s.

Question: how did the translation of the triplet anti codon to amino acids, and its assignment, arise ?  There is no physical affinity between the anti codon and the amino acids. What must be explained, is the arrangement of the codon " words " in the standard codon table which is highly non-random, redundant and optimal, and serves to translate the information into the amino acid sequence to make proteins, and the origin of the assignment of the 64 triplet codons to the 20 amino acids. That is, the origin of its translation. The origin of a alphabet through the triplet codons is one thing, but on top, it has to be translated to a other " alphabet " constituted through the 20 amino acids. That is as to explain the origin of capability to translate the english language into chinese. We have to constitute the english and chinese language and symbols first, in order to know its equivalence. That is a mental process.
Stephen Meyer, Signature in the cell, page 99:
nothing about the physical or chemical features of the nucleotides or amino acids directly dictated any particular set of assignments between amino acids and bases in the DNA text. The code could not be deduced from the chemical properties of amino acids and nucleotide bases. Just as a specific letter of the English language can be represented by any combination of binary digits, so too could a given amino acid correspond to any combination of nucleotide bases.

tRNA's are adapter molecules. A cipher or translation system  permits  the translation of the information from DNA’s four-character base sequences into the twenty-character “language” of proteins. the cell needs a means of translating and expressing the information stored on DNA. Groups of three nucleotides (called codons) on the mRNA specify the addition of one of the twenty protein-forming amino acids during the process of protein synthesis. Other scientists discovered that the cell uses a set of adapter molecules to help convert the information on mRNA into proteins.

how did biological specificity and functional information arise?The proteins would have to possess the correct sequences of amino acids in order to be able to unwind and copy genetic information; the ribosomal proteins and RNAs would need to be sequenced precisely in order to fold into subunits that fit together to form a functional ribosome; the transfer RNAs would have to mediate specific associations in order to convert the random sequences of bases on the polynucleotides into specific amino-acid sequences; and the sequences of amino acids thus produced would have to be arranged precisely in order to fold into stable three-dimensional structures.


The sequence of nucleotides in the mRNA molecule is read in consecutive groups of three. RNA is a linear polymer of four different nucleotides, so there are 4 x 4 x 4 = 64 possible combinations of three nucleotides: the triplets AAA, AUA, AUG, and so on. However, only 20 different amino acids are commonly found in proteins. Either some nucleotide triplets are never used, or the code is redundant and some amino acids are specified by more than one triplet. The second possibility is, in fact, the correct one, as shown by the completely deciphered genetic code shown below:





Each group of three consecutive nucleotides in RNA is called a codon, and each codon specifies either one amino acid or a stop to the translation process.

In principle, an RNA sequence can be translated in any one of three different reading frames, depending on where the decoding process begins (Figure below). However, only one of the three possible reading frames in an mRNA encodes the required protein. We see later how a special punctuation signal at the beginning of each RNA message sets the correct reading frame at the start of protein synthesis.

AUG is the Universal Start Codon. Nearly every organism (and every gene) that has been studied uses the three ribonucleotide sequence AUG to indicate the "START" of protein synthesis (Start Point of Translation).

The same interrogation point goes here : Why and how should natural processes have " chosen " to insert a punctuation signal, a Universal Start Codon in order for the Ribosome to " know " where to start translation ? This is essential in order for the machinery to start translating at the correct place.



Note that three codons are referred to as STOP codons: UAA, UAG, and UGA. These are used to terminate translation; they indicate the end of the gene's coding region.




tRNA Molecules match Amino Acids to codons in mRNA

The codons in an mRNA molecule do not directly recognize the amino acids they specify: the group of three nucleotides does not, for example, bind directly to the amino acid. Rather, the translation of mRNA into protein depends on adaptor molecules that can recognize and bind both to the codon and, at another site on their surface, to the amino acid. These adaptors consist of a set of small RNA molecules known as transfer RNAs (tRNAs), each about 80 nucleotides in length.

RNA molecules can fold into precise three-dimensional structures, and the tRNA molecules provide a striking example. Four short segments of the folded tRNA are double-helical, producing a molecule that looks like a cloverleaf when drawn schematically. See below:



For example, a 5"-GCUC-3" sequence in one part of a polynucleotide chain can form a relatively strong association with a 5"-GAGC-3" sequence in another region of the same molecule. The cloverleaf undergoes further folding to form a compact L-shaped structure that is held together by additional hydrogen bonds between different regions of the molecule. Two regions of unpaired nucleotides situated at either end of the L-shaped molecule are crucial to the function of tRNA in protein synthesis. One of these regions forms the anticodon, a set of three consecutive nucleotides that pairs with the complementary codon in an mRNA molecule. The other is a short single- stranded region at the 3" end of the molecule; this is the site where the amino acid that matches the codon is attached to the tRNA. The genetic code is redundant; that is, several different codons can specify a single amino acid . This redundancy implies either that there is more than one tRNA for many of the amino acids or that some tRNA molecules can base-pair with more than one codon. In fact, both situations occur. Some amino acids have more than one tRNA and some tRNAs are constructed so that they require accurate base-pairing only at the first two positions of the codon and can tolerate a mismatch (or wobble) at the third position . See below



Wobble base-pairing between codons and anticodons. If the nucleotide listed in the first column is present at the third, or wobble, position of the codon, it can base-pair with any of the nucleotides listed in the second column. Thus, for example, when inosine (I) is present in the wobble position of the tRNA anticodon, the tRNA can recognize any one of three different codons in bacteria and either of two codons in eucaryotes. The inosine in tRNAs is formed from the deamination of guanine, a chemical modification that takes place after the tRNA has been synthesized. The nonstandard base pairs, including those made with inosine, are generally weaker than conventional base pairs. Note that codon–anticodon base pairing is more stringent at positions 1 and 2 of the codon: here only conventional base pairs are permitted. The differences in wobble base-pairing interactions between bacteria and eucaryotes presumably result from subtle structural differences between bacterial and eucaryotic ribosomes, the molecular machines that perform protein synthesis.

(Adapted from C. Guthrie and J. Abelson, in The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, pp. 487–528. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 1982.)

This wobble base-pairing explains why so many of the alternative codons for an amino acid differ only in their third nucleotide . In bacteria, wobble base-pairings make it possible to fit the 20 amino acids to their 61 codons with as few as 31 kinds of tRNA molecules. The exact number of different kinds of tRNAs, however, differs from one species to the next. For example, humans have nearly 500 tRNA genes but, among them, only 48 different anticodons are represented.

Specific enzymes couple each Amino Acid to its appropriate tRNA Molecule

We have seen that, to read the genetic code in DNA, cells make a series of different tRNAs. We now consider how each tRNA molecule becomes linked to the one amino acid in 20 that is its appropriate partner. Recognition and attachment of the correct amino acid depends on enzymes called aminoacyl-tRNA synthetases, which covalently couple each amino acid to its appropriate set of tRNA molecules





Most cells have a different synthetase enzyme for each amino acid (that is, 20 synthetases in all); one attaches glycine to all tRNAs that recognize codons for glycine, another attaches alanine to all tRNAs that recognize codons for alanine, and so on. Many bacteria, however, have fewer than 20 synthetases, and the same synthetase enzyme is responsible for coupling more than one amino acid to the appropriate tRNAs. In these cases, a single synthetase places the identical amino acid on two different types of tRNAs, only one of which has an anticodon that matches the amino acid. A second enzyme then chemically modifies each “incorrectly” attached amino acid so that it now corresponds to the anticodon displayed by its covalently linked tRNA. The synthetase-catalyzed reaction that attaches the amino acid to the 3" end of the tRNA is one of many reactions coupled to the energy-releasing hydrolysis of ATP , and it produces a high-energy bond between the tRNA and the amino acid. The energy of this bond is used at a later stage in protein synthesis to link the amino acid covalently to the growing polypeptide chain. The aminoacyl-tRNA synthetase enzymes and the tRNAs are equally important in the decoding process





These enzymes are not gentle with tRNA molecules. The structure of glutaminyl-tRNA synthetase with its tRNA (entry 1gtr) is a good example ( see above ) The enzyme firmly grips the anticodon, spreading the three bases widely apart for better recognition. At the other end, the enzyme unpairs one base at the beginning of the chain, seen curving upward here, and kinks the long acceptor end of the chain into a tight hairpin, seen here curving downward. This places the 2' hydroxyl on the last nucleotide in the active site, where ATP and the amino acid (not present in this structure) are bound.

The tRNA and ATP fits precisely in the active site of the enzyme, and the structure is  configured and designed to function in a finely tuned manner. How could such a functional device be the result of random unguided forces and chemical reactions without a end goal ?


The genetic code is translated by means of two adaptors that act one after another. The first adaptor is the aminoacyl-tRNA synthetase, which couples a particular amino acid to its corresponding tRNA; the second adaptor is the tRNA molecule itself, whose anticodon forms base pairs with the appropriate codon on the mRNA. An error in either step would cause the wrong amino acid to be incorporated into a protein chain. In the sequence of events shown, the amino acid tryptophan (Trp) is selected by the codon UGG on the mRNA.

This was established by an experiment in which one amino acid (cysteine) was chemically converted into a differentamino acid (alanine) after it already had been attached to its specific tRNA. When such “hybrid” aminoacyl-tRNA molecules were used for protein synthesis in a cell-free system, the wrong amino acid was inserted at every point in the protein chain where that tRNA was used. Although, as we shall see, cells have several quality control mechanisms to avoid this type of mishap, the experiment establishes that the genetic code is translated by two sets of adaptors that act sequentially. Each matches one molecular surface to another with great specificity, and it is their combined action that associates each sequence of three nucleotides in the mRNA molecule—that is, each codon—with its particular amino acid.

Editing by tRNA Synthetases Ensures Accuracy

Several mechanisms working together ensure that the tRNA synthetase links the correct amino acid to each tRNA. The synthetase must first select the correct amino acid, and most synthetases do so by a two-step mechanism. First, the correct amino acid has the highest affinity for the active-site pocket of its synthetase and is therefore favored over the other 19. In particular, amino acids larger than the correct one are effectively excluded from the active site. However, accurate discrimination between two similar amino acids, such as isoleucine and valine (which differ by only a methyl group), is very difficult to achieve by a one-step recognition mechanism. A second discrimination step occurs after the amino acid has been covalently linked to AMP. When tRNA binds the synthetase, it tries to force the amino acid into a second pocket in the synthetase, the precise dimensions of which exclude the correct amino acid but allow access by closely related amino acids. Once an amino acid enters this editing pocket, it is hydrolyzed from the AMP (or from the tRNA itself if the aminoacyl-tRNA bond has already formed), and is released from the enzyme. This hydrolytic editing, which is analogous to the exonucleolytic proofreading by DNA polymerases , raises the overall accuracy of tRNA charging to approximately one mistake in 40,000 couplings.

Editing significantly decreases the frequency of errors and is important for translational quality control, and many details of the various editing mechanisms and their effect on different cellular systems are now starting to emerge. 8

High Fidelity

Aminoacyl-tRNA synthetases must perform their tasks with high accuracy. Every mistake they make will result in a misplaced amino acid when new proteins are constructed. These enzymes make about one mistake in 10,000. For most amino acids, this level of accuracy is not too difficult to achieve. Most of the amino acids are quite different from one another, and, as mentioned before, many parts of the different tRNA are used for accurate recognition. But in a few cases, it is difficult to choose just the right amino acids and these enzymes must resort to special techniques.

Isoleucine is a particularly difficult example. It is recognized by an isoleucine-shaped hole in the enzyme, which is too small to fit larger amino acids like methionine and phenylalanine, and too hydrophobic to bind anything with polar sidechains. But, the slightly smaller amino acid valine, different by only a single methyl group, also fits nicely into this pocket, binding instead of isoleucine in about 1 in 150 times. This is far too many errors, so corrective steps must be taken. Isoleucyl-tRNA synthetase (PDB entry 1ffy) solves this problem with a second active site, which performs an editing reaction. Isoleucine does not fit into this site, but errant valine does. The mistake is then cleaved away, leaving the tRNA ready for a properly-placed leucine amino acid. This proofreading step improves the overall error rate to about 1 in 3,000.  9

This is a amazing error proofreading technique, which adds to other repair mechanisms in the cell. Once again the question arises : How could these precise molecular machines have arisen by natural means, without intelligence involved ? This seems to me one more amazing example of highly sophisticated nano molecular machinery designed to fullfill its task with high degree of findelity and error minimization, which can arise only by the forsight of a incredibly intelligent creator. 






A new peer-reviewed paper in the journal Frontiers in Genetics, "Redundancy of the genetic code enables translational pausing," finds that so-called "redundant" codons may actually serve important functions in the genome. Redundant (also called "degenerate") codons are those triplets of nucleotides that encode the same amino acid. For example, in the genetic code, the codons GGU, GGC, GGA, and GGG all encode the amino acid glycine. While it has been shown (see here) that such redundancy is actually optimized to minimize the impact of mutations resulting in amino acid changes, it is generally assumed that synonymous codons are functionally equivalent. They just encode the same amino acid, and that's it.  5

The ribosome is capable of reading both sets of commands -- as they put it, "[t]he ribosome can be thought of as an autonomous functional processor of data that it sees at its input." To put it another way, the genetic code is "multidimensional," a code within a code. This multidimensional nature exceeds the complexity of computer codes generated by humans, which lack the kind of redundancy of the genetic code. As the abstract states:

The codon redundancy ("degeneracy") found in protein-coding regions of mRNA also prescribes Translational Pausing (TP). When coupled with the appropriate interpreters, multiple meanings and functions are programmed into the same sequence of configurable switch-settings. This additional layer of Ontological Prescriptive Information (PIo) purposely slows or speeds up the translation decoding process within the ribosome. Variable translation rates help prescribe functional folding of the nascent protein. Redundancy of the codon to amino acid mapping, therefore, is anything but superfluous or degenerate. Redundancy programming allows for simultaneous dual prescriptions of TP and amino acid assignments without cross-talk. This allows both functions to be coincident and realizable. We will demonstrate that the TP schema is a bona fide rule-based code, conforming to logical code-like properties. Second, we will demonstrate that this TP code is programmed into the supposedly degenerate redundancy of the codon table. We will show that algorithmic processes play a dominant role in the realization of this multi-dimensional code.

The paper even suggests, "Cause-and-effect physical determinism...cannot account for the programming of sequence-dependent biofunction."

Crucial role of the tRNA activating enzymes 7

To try to explain the source of the code various researchers have sought some sort of chemical affinity between amino acids and their corresponding codons. But this approach is misguided:

First of all, the code is mediated by tRNAs which carry the anti-codon (in the mRNA) rather than the codon itself (in the DNA). So, if the code were based on affinities between amino acids and anti-codons, it implies that the process of translation via transcription cannot have arisen as a second stage or improvement on a simpler direct system - the complex two-step process would need to have arisen right from the start.

Second, the amino acid has no role in identifying the tRNA or the codon (see Footnote). This association is done by an activating enzyme (see Figure 2) which attaches each amino acid to its appropriate tRNA (clearly requiring the enzyme to correctly identify both components). There are 20 different activating enzymes - one for each type of amino acid.

Interestingly, the end of the tRNA to which the amino acid attaches has the same nucleotide sequence for all amino acids - which constitutes a third reason.
Interest in the genetic code tends to focus on the role of the tRNAs, but as just indicated that is only one half of implementing the code. Just as important as the codon-anticodon pairing (between mRNA and tRNA) is the ability of each activating enzyme to bring together an amino acid with its appropriate tRNA. It is evident that implementation of the code requires two sets of intermediary molecules: the tRNAs which interact with the ribosomes and recognise the appropriate codon on mRNA, and the activating enzymes which attach the right amino acid to its tRNA. This is the sort of complexity that pervades biological systems, and which poses such a formidable challenge to an evolutionary explanation for its origin. It would be improbable enough if the code were implemented by only the tRNAs which have 70 to 80 nucleotides; but the equally crucial and complementary role of the activating enzymes, which are hundreds of amino acids long, excludes any realistic possibility that this sort of arrangement could have arisen opportunistically.


Progressive development of the genetic code is not realistic

In view of the many components involved in implementing the genetic code, origin-of-life researchers have tried to see how it might have arisen in a gradual, evolutionary, manner. For example, it is usually suggested that to begin with the code applied to only a few amino acids, which then gradually increased in number. But this sort of scenario encounters all sorts of difficulties with something as fundamental as the genetic code.

First, it would seem that the early codons need have used only two bases (which could code for up to 16 amino acids); but a subsequent change to three bases (to accommodate 20) would seriously disrupt the code. Recognising this difficulty, most researchers assume that the code used 3-base codons from the outset; which was remarkably fortuitous or implies some measure of foresight on the part of evolution (which, of course, is not allowed).

Much more serious are the implications for proteins based on a severely limited set of amino acids. In particular, if the code was limited to only a few amino acids, then it must be presumed that early activating enzymes comprised only that limited set of amino acids, and yet had the necessary level of specificity for reliable implementation of the code. There is no evidence of this; and subsequent reorganization of the enzymes as they made use of newly available amino acids would require highly improbable changes in their configuration. Similar limitations would apply to the protein components of the ribosomes which have an equally essential role in translation.

Further, tRNAs tend to have atypical bases which are synthesized in the usual way but subsequently modified. These modifications are carried out by enzymes, so these enzymes too would need to have started life based on a limited number of amino acids; or it has to be assumed that these modifications are later refinements - even though they appear to be necessary for reliable implementation of the code.

Finally, what is going to motivate the addition of new amino acids to the genetic code? They would have little if any utility until incorporated into proteins - but that will not happen until they are included in the genetic code. So the new amino acids must be synthesised and somehow incorporated into useful proteins (by enzymes that lack them), and all of the necessary machinery for including them in the code (dedicated tRNAs and activating enzymes) put in place – and all done opportunistically! Totally incredible!


What must be explained, is  the arrangement of the codons in the standard codon table which is highly non-random, and serves to translate into the amino acid sequence to make proteins, and the origin of the assignment of the 64 triplet codons to the 20 amino acids. That is, the origin of its translation. The origin of a alphabet through the triplet codons is one thing, but on top, it has to be translated to a other " alphabet " constituted through the 20 amino acid sequence. That is, as to explain the origin of capability to translate the english language into chinese.  On top of that, the machinery itself to promote the process itself has also to be explained, that is the hardware. When humans translate english to chinese, for example, we recognise the english word, and the translator knows the equivalent chinese symbol and writes it down. 


In the cell,  Aminoacyl tRNA synthetase recognise the triplet anticodon of the tRNA, and attach the equivalent amino acid to the tRNA. How could random chemical reactions have produced this recognition ? Lets suppose rather than intelligence, chance were the mechanism. The imaginary cell would have to select randomly any of the amino acids, restrict by a unknown mechanism to the 20 used for life, since there are more out there, select by a unknown mechanism only left handed ones, and make a test drive and produce a polynucleotide and see what happens. Some theories try to explain the mechanism, but they all remain unsatisfactory. Obviously. Furthermore, Aminoacyl tRNA synthetase are complex enzymes. For what reason would they have come to be, if the final function could only be employd after the whole translation process was set in place, with a fully functional ribosome being able to do its job? Remembering  the catch22 situation, since they are by themself made through the very own process in question ? 

 Why is it not rational to conclude that the code itself, the software, as well as the hardware, are best explained through the invention of a highly intelligent being, rather than random chemical affinities and reactions? Questions: what good would the ribosome be for without tRNA's ? without amino acids, which are the product of enormously complex chemical processes and pathways ? What good would the machinery be good for, if the code was not established, and neither the assignment of each codon to the respective amino acid ? had the software and the hardware not have to be in place at the same time? Were all the parts not only fully functional if fully developed, interlocked, set-up, and tuned to do its job with precision like a human made motor ? 


And even it lets say, the whole thing was fully working and in place, what good would it be for without all the other parts required, that is, the DNA double helix, its compactation through histones and chromatins and chromosomes, its highly complex mechanism of information extraction and transcription into mRNA?  Had the whole process , that is   INITIATION OF TRANSCRIPTION, CAPPING,  ELONGATION,  SPLICING, CLEAVAGE,POLYADENYLATION AND TERMINATION, EXPORT FROM THE NUCLEUS TO THE CYTOSOL, INITIATION OF PROTEIN SYNTHESIS (TRANSLATION), COMPLETION OF PROTEIN SYNTHESIS AND PROTEIN FOLDING, and its respective machinery not have to be all in place ? Does that not constitute a interdependent, and irreducible complex system ? 


Koonin, the logic of chance, page 237
The origin of translation: The key ideas and models
During the 40 years since the discovery of the translation mechanism and deciphering of the genetic code, numerous theoretical (inevitably, speculative, sometimes far-fetched, often highly ingenious) models of the origin and evolution of various components of the translation apparatus and different aspects of the translation process have been proposed. It is unrealistic to provide here a thorough critical review of these models. Instead, I consider a few central ideas that are germane to the thinking about the origin of translation and then discuss in somewhat greater detail the only two coherent scenarios I am aware of. The main general point about the evolution of translation is that selection for protein synthesis could not have been the underlying cause behind the origin of the translation system. To evolve this complex system via the Darwinian route, numerous steps are required, but proteins appear only at the last steps; until that point, an evolving organism “does not know” how good proteins could be.

The DNA - Enzyme System is Irreducibly Complex 10

An often undiscussed aspect of complexity is how the tRNA get assigned to the right amino acids. For the DNA language to be translated properly, each tRNA codon must be attached to the correct amino acid. If this crucial step in DNA replication is not functional, then the language of DNA breaks down. Special enzymes called aminoacyl - tRNA synthetases (aaRSs) ensure that the proper amino acid is attached to a tRNA with the correct codon through a chemical reaction called "aminoacylation." Accurate translation requires not only that each tRNA be assigned the correct amino acid, but also that it not be aminoacylated by any of the aaRS molecules for the other 19 amino acids. One biochemistry textbook notes that because all aaRSs catalyze similar reactions upon various similar tRNA molecules, it was thought they "evolved from an common ancestor and should therefore be structurally related." (Voet and Voet pg. 971-975) However, this was not the case as the, "aaRSs form a diverse group of [over 100] enzymes … and there is little sequence similarity among synthetases specific for different amino acids." (Voet and Voet pg. 971-975) Amazingly, these aaRSs themselves are coded for by the DNA: this forms the essence of a chicken-egg problem. The enzymes themselves build help perform the very task which constructs them!

Stephen Meyer writes in Biocomplexitys paper :

Can the Origin of the Genetic Code Be Explained by Direct RNA Templating? 1  following :

The three main naturalistic concepts on the origin and evolution of the code are the stereochemical theory, according to which codon assignments are dictated by physico-chemical affinity between amino acids and the cognate codons (anticodons).

The genetic code as we observe it today is a semantic (symbol- based) relation between (a) amino acids, the building blocks of proteins, and (b) codons, the three-nucleotide units in messen- ger RNA specifying the identity and order of different amino acids in protein assembly.  The actual physical mediators of the code, however, are trans- fer RNAs (tRNAs) that, after being charged with their specific amino acids by enzymes known as aminoacyl transfer RNA synthetases (aaRSs), present the amino acids for peptide bond formation in the peptidyl-transferase (P) site of the ribosome, the molecular machine that constructs proteins.


When proteins are produced in cells based on the "genetic code" of codons, there is a precise process under which molecules called transfer RNA (tRNA) bind to specific amino acids and then transport them to cellular factories called ribosomes where the amino acids are placed together, step by step, to form a protein. Mistakes in this process, which is mediated by enzymes called synthetases, can be disastrous, as they can lead to improperly formed proteins. Thankfully, the tRNA molecules are matched to the proper amino acids with great precision, but we still lack a fundamental understanding of how this selection takes place. 4



The secondary structure of a typical tRNA see figure below, reveals the coding (semantic) relations that Yarus et al. are trying to obtain from chemistry alone - a quest Yockey has compared to latter-day alchemy


At the end of its 3' arm, the tRNA binds its cognate amino acid via the universally conserved CCA sequence. Some distance away—about 70 Å—in loop 2, at the other end of the inverted cloverleaf, the anticodon recognizes the corresponding codon in the mRNA strand.  (The familiar ‘cloverleaf’ shape represents only the secondary structure of tRNA; its three-dimensional form more closely resembles an “L” shape, with the anticodon at one end and an amino acid at the other.)Thus, in the current genetic code, there is no direct chemical interaction between codons, anticodons, and amino acids. The anticodon triplet and amino acid are situated at opposite ends of the tRNA: the mRNA codon binds not to the amino acid directly, but rather to the anticodon triplet in loop 2 of the tRNA.

Since all twenty amino acids, when bound to their corresponding tRNA molecules, attach to the same CCA sequence at the end of the 3’ arm, the stereochemical properties of that nucleotide sequence clearly do not determine which amino acids attach, and which do not. The CCA sequence is indifferent, so to speak, to which amino acids bind to it

Nevertheless, tRNAs are informationally (i.e., semantically) highly specific: protein assembly and biological function—but not chemistry—demand such specificity. As noted, in the current code, codon-to-amino acid semantic mappings are mediated by tRNAs, but also by the enzymatic action of the twenty separate aminoacyl-tRNA synthetases


Aminoacyl tRNA synthetase

An aminoacyl tRNA synthetase (aaRS) is an enzyme that catalyzes the esterification of a specific cognate amino acid or its precursor to one of all its compatible cognate tRNAs to form an aminoacyl-tRNA. In other words, aminoacyl tRNA synthetase attaches the appropriate amino acid onto its tRNA.
This is sometimes called "charging" or "loading" the tRNA with the amino acid. Once the tRNA is charged, a ribosome can transfer the amino acid from the tRNA onto a growing peptide, according to the genetic code. Aminoacyl tRNA therefore plays an important role in DNA translation, the expression of genes to create proteins. 2


This set of twenty enzymes knows what amino acid to fasten to one end of a transfer-RNA (tRNA) molecule, based on the triplet codon it reads at the other end. It's like translating English to Chinese. A coded message is complex enough, but the ability to translate a language into another language bears the hallmarks of intelligent design. 6

Most cells use twenty aaRS enzymes, one for each amino acid. Each of these proteins recognizes a specific amino acid and the specific anticodons it binds to within the code. They then bind amino acids to the tRNA that bears the corresponding anticodon.

Thus, instead of the code reducing to a simple set of stereochemical affinities, biochemists have found a functionally interdependent system of highly specific molecules, including mRNA, a suite of tRNAs, and twenty specific aaRS enzymes, each of which is itself constructed from information stored on the very DNA strands that the system as a whole decodes.

Attempts to explain one part of the integrated complexity of the gene-expression system, namely the genetic code, by reference to simple chemical affinities lead not to simple rules of chemical attraction, but instead to an integrated system of multiple large molecular components. While this information-transmitting system exploits (i.e., uses) chemistry, it is not reducible to direct chemical affinities between codons or anticodons and their cognate amino acids.

The DRT model and the sequencing problem

One further aspect of Yarus’s work needs clarification and critique. One of the longest-standing and most vexing problems in origin-of-life research is known as the sequencing problem, the problem of explaining the origin of the specifically-arranged sequences of nucleotide bases that provide the genetic information or instructions for building proteins.
Yet, in addition to its other deficiencies it is important to point out that Yarus et al. do not solve the sequencing problem, although they do claim to address it indirectly. Instead, Yarus et al. attempt to explain the origin of the genetic code—or more precisely, one aspect of the translation system, the origin of the associations between certain RNA triplets and their cognate amino acids.

Yarus et al. want to demonstrate that particular RNA triplets show chemical affinities to particular amino acids (their cognates in the present-day code). They try to do this by showing that in some RNA strands, individual triplets and their cognateamino acids bind preferentially to each other. They then envision that such affinities initially provided a direct (stereochemical) template for amino acids during protein assembly.

Since Yarus et al. think that stereochemical affinities originally caused protein synthesis to occur by direct templating, they also seem to think that solving the problem of the origin of the code would also simultaneously solve the problem of sequencing. But this does not follow. Even if we assume that Yarus et al. have succeeded in establishing a stereochemical basis for the associations between RNA triplets and amino acids in the present-day code (which they have not done; see above), they would not have solved the problem of sequencing.

The sequencing problem requires that long RNA strands would need to contain triplets already arranged to bind their cognate amino acids in the precise order necessary to assemble functional proteins. Yarus et al. analyzed RNA strands enriched in specific code-relevant triplets, and claim to have found that these strands show a chemical affinity with their cognate amino acids. But they did not find RNA strands with a properly sequenced series of triplets, each forming an association with a code-relevant amino acid as the DRT model would require, and arranged in the kind of order required to make functional proteins. To synthesize proteins by direct templating (even assuming the existence of all necessary affinities), the RNA template must have many properly sequenced triplets, just as we find in the actual messenger RNA transcripts.

1) file:///E:/Downloads/43-308-1-PB%20(1).pdf
2) https://en.wikipedia.org/wiki/Aminoacyl_tRNA_synthetase
3) http://pubs.acs.org/subscribe/archive/mdd/v04/i03/html/03timeline.html
4) http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4323281/
http://www.riken.jp/en/pr/press/2014/20140612_1_yokoyama/
http://www.evolutionnews.org/2014/07/each_time_genom088091.html
5) http://www.evolutionnews.org/2014/08/paper_finds_fun089301.html
6) http://www.evolutionnews.org/2015/06/from_chemicals096611.html
7) http://www.c4id.org.uk/index.php?option=com_content&view=article&id=211:the-problem-of-the-origin-of-life&catid=50:genetics&Itemid=43
8 )http://www.ncbi.nlm.nih.gov/pubmed/19379069
9) http://www.rcsb.org/pdb/101/motm.do?momID
10) http://www.ideacenter.org/contentmgr/showdetails.php/id/845
11) http://creationsafaris.com/epoi_c09.htm



Last edited by Admin on Thu Mar 30, 2017 6:19 am; edited 28 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Materialism Cannot Explain the Origin of the Genetic Code. Intelligent Design is a More Reasonable Explanation.

http://ncu9nc.blogspot.com.br/2013/04/materialism-cannot-explain-origin-of.html

Materialism cannot explain the origin of the genetic code. The probability that the necessary chemical reactions could occur through the unguided working of physical laws is too low. No one who has investigated the problem believes there is a satisfactory explanation of how life or the genetic code could arise through natural means. For the genetic code to work, there has to be a semiotic system to use DNA or RNA to represent the sequence of amino acids in each protein and there has to be a cybernetic system to produce the machinery that uses the genetic code to produce proteins. This requires: The development of the code whereby each possible triplet of nucleotides represents an amino acid.  The determination of the sequence of amino acids for each protein that is to be produced.  The creation of the specific genes (molecules of DNA or maybe RNA) that use the triplet code to specify the proteins. The many tRNAs, one for each triplet, and the amino acids and enzymes that combine amino acids and tRNA.

Ribosomes.
All of this has to come into existence at the same time because:

The parts are not useful individually.  But paradoxically, according to materialism these parts are the information and machinery that is needed to produce itself.  Furthermore, the genetic code is finely tuned to reduce the effects of point mutations and there is no explanation as to how the genetic code could evolve from something simpler, something less finely tuned. Any change in the genetic code would be catastrophic because it would effect every gene. It would be like changing every letter "n" to the letter "p" in an entire book. It would create so many "misspellings" for an organism that it is impossible that it could survive. Evolving from a double code to a triplet code would require simultaneous changes in every codon in every gene and in all the tRNAs and the mechanism that moves the mRNA with respect to the ribosome during protein synthesis. All these parts have to be produced in the correct numbers and arranged in a configuration where they will work together. These factors all contribute to the impossibly low probability of the genetic code arising through the unguided action of natural forces, chance, self assembly, and/or evolution. However, we know there is a phenomenon that can create semiotic and cybernetic systems that would otherwise have no chance of arising through natural processes. This phenomenon is intelligence. Therefore it is reasonable to suppose that the genetic code was created by an intelligence. This is not a "god of the gaps" argument. It is the same mode of logic, "like phenomena have like causes"8, whereby the measurement of gravity on earth leads to the conclusion that gravity causes the planets to orbit the sun. It is the same mode of logic used by many early naturalists, such as geologist Charles Lyell, to explain phenomena that occurred in the remote past by identifying causes known to be effective in the present time. Additionally, you don't need evidence of who the intelligence was to make this supposition. If a NASA space craft found machinery on Mars, we would not think that the machinery arose naturally just because there were no Martians around who could have made it. The existence of machinery that could not arise naturally is sufficient to conclude the existence of an intelligent maker.

However, the belief that naturalism can explain something that current science says is impossible is a "god of the gaps" argument. Our current understanding of chemistry and the conditions on the early earth says there is no good natural explanation for the origin of life and the genetic code.1 To disregard science and maintain faith in naturalism is a "god of the gaps" argument. To paraphrase the Nobel prize winning neurophysiologist Sir John Eccles: Promissory materialism is superstition.

http://www.discovery.org/a/1059

Experiments to change the identity of transfer RNA (tRNA)--another possible mechanism by which genetic codes might reassign codon "meanings"--have shown that the intermediate steps must be bridged by intelligent (directed) manipulation. In one such experiment, for instance, Margaret Saks, John Abelson, and colleagues at Caltech changed an E. coli arginine tRNA to specify a different amino acid, threonine. They accomplished this, however, only by supplying the bacterial cells (via a plasmid) with another copy of the wild-type threonine tRNA gene. This intelligently-directed intervention bridged the critical transition stage during which the arginine tRNA was being modified by mutations to specify threonine. [6] Indeed, in reporting on an earlier experiment to modify tRNA, Abelson and colleagues noted that "if multiple changes are required to alter the specificity of a tRNA, they cannot be selected but they can be constructed" [7]--constructed, that is, by intelligent design. We stress here that, in contrast to Miller's blithe dismissal of the difficulties raised for biotechnology by variant genetic codes, experts in the field caution that assuming a "universal" code may lead to serious problems. In a recent article on the topic entitled "Codon reassignment and the evolving genetic code: problems and pitfalls in post-genome analysis," Justin O'Sullivan and colleagues at the University of Kent observe:

"The emerging non-universal nature of the genetic code, coupled with the fact that few genetic codes have been experimentally confirmed, has several serious implications for the post-genome era. The production of biologically active recombinant molecules requires that careful consideration be given to both the expression system and the original host genome. The substitution of amino acids within a protein encoded by a nonstandard genetic code could alter the structure, function or antibody recognition of the final product."



Last edited by Admin on Thu Mar 30, 2017 6:20 am; edited 2 times in total

View user profile http://elshamah.heavenforum.com

3 The Finely Tuned Genetic Code on Tue Jun 30, 2015 5:51 pm

Admin


Admin
The Finely Tuned Genetic Code

http://www.evolutionnews.org/2011/11/the_finely_tuned_genetic_code052611.html

Francis Crick regarded the genetic code found in nature as a "frozen accident." Yet more and more it is looking to be the case that this code is exquisitely finely tuned -- with features suggesting it is indeed one in a million. Therefore ought not purposive or intelligent design be regarded as a legitimate inference, as the best explanation for how the code came into existence?

We are all familiar with the genetic code by virtue of which an mRNA transcript is translated into the amino acid residues that form proteins. Triplets of nucleotides -- called "codons" -- serve as "molecular words," each of them specifying a particular amino acid or the stop sites of open reading frames (ORFs). Ribosomes and tRNA-methionine complexes (called "charged" methionyl tRNAs) attach near the 5' end of the mRNA molecule at the initiation codon AUG (which specifies the amino acid methionine) and begin to translate its ribonucleotide sequences into the specific amino acid sequence necessary to form a functional protein. Each amino acid becomes attached at its carboxyl terminus to the 3' end of its own species of tRNA by an enzyme known as amino-acyl tRNA synthetase.

Two sites exist on a ribosome for activated tRNAs: the peptidyl site and the amino-acyl site (P site and A site respectively). The initiation codon, carrying methionine, enters the P site. The 3' UAC 5' anticodon of the tRNA is paired with the complementary 5' AUG 3' mRNA codon. The second tRNA enters the A site. An enzymatic part of the ribosome called peptidyl transferase then creates a peptide bond to link the two amino acids. Upon formation of the peptide bond, the amino-acyl bond that connected the amino acid to its corresponding tRNA is broken, and the tRNA is thus able to leave the P site. This is followed by ribosomal translocation to position a new open codon in the empty A site and also move the second tRNA -- which is now bonded to a dipeptide -- from the A to the P site. And so the cycle repeats until the occurrence of a stop codon that prevents further chain elongation.

The total number of possible RNA triplets amounts to 64 different codons. Of those, 61 specify amino acids, with the remaining three (UAG, UAA and UGA) serving as stop codons, which halt the process of protein synthesis. Because there are only twenty different amino acids, some of the codons are redundant. This means that several codons can code for the same amino acid. The cellular pathways and mechanisms that make this 64-to-20 mapping possible is a marvel of molecular logic. It's enough to make any engineer to drool. But the signs of design extend well beyond the sheer engineering brilliance of the cellular translation apparatus. In this article, I will show several layers of design ingenuity exhibited by this masterpiece of nanotechnology.

How Is the Genetic Code Finely Tuned?

As previously stated, the genetic code is degenerate. This means that multiple codons will often signify the same amino acid. This degeneracy is largely caused by variation in the third position, which is recognized by the nucleotide at the 5' end of the anticodon (the so-called "wobble" position). The wobble hypothesis states that nucleotides that are present in this position can make interactions that aren't permitted in the other positions (though it still leaves some interactions that aren't allowed).

But this arrangement is far from arbitrary. Indeed, the genetic code found in nature is exquisitely tuned to protect the cell from the detrimental effects of substitution mutations. The system is so brilliantly set up that codons differing by only a single base either specify the same amino acid, or an amino acid that is a member of a related chemical group. In other words, the structure of the genetic code is set up to mitigate the effects of errors that might be incorporated during translation (which can occur when a codon is translated by an almost-complementary anti-codon).

For example, the amino acid leucine is specified by six codons. One of them is CUU. Substitution mutations in the 3' position which change a U to a C, A or G result in the alteration of the codons to ones which also specify leucine: CUC, CUA and CUG respectively. On the other hand, if the C in the 5' position is substituted for a U, the codon UUU results. This codon specifies phenylalanine, an amino acid which exhibits similar physical and chemical properties to leucine. The fact in need of explaining is thus that codon assignments are ordered in such a way as to minimize ORF degradation. In addition, most codons specify amino acids that possess simple side chains. This decreases the propensity of mutations to produce codons encoding amino acid sequences which are chemically disruptive.

Freeland et al. (2000) show that the genetic code is highly optimized -- indeed "the best of all possible codes" -- taking into account two parameters: first, the relative likelihood of transitions and transversions; and second, the relative impact of mutation.

The Failed Rejection Problem

Another paper, by Lim and Curran (2001), models the specificity of correct codon-anticodon duplex formation during translation. According to their model, for an incorrect duplex to be rejected by the ribosome, it is necessary for it to have at least one uncompensated hydrogen bond: a criterion which presents difficulties when duplexes have a pair of pyrimidines (i.e. U or C) in the codon's third position, i.e. the wobble position. Pyrimidine bases are somewhat smaller than purine (G and A) bases and, in the wobble position, can allow certain mismatches in the second position to produce non-Watson-Crick pairs that compensate the missing hydrogen bonds. This results in a mistranslation event because the mismatches in the second position are not properly rejected.

This problem can be circumvented by preventing an anticodon's pyrimidine in the wobble position from forming a pyrimidine pair. Such a modification entails that a single anticodon that could have recognized four codons is now able to recognize only two. So there will now need to be one tRNA for the pyrimidines of the wobble position and another tRNA for the purines of the wobble position. This explains why 32 codons (those ending with A and G) in the standard genetic code are in "family boxes," and the other 32 (those ending with C and U) are in "split boxes." Indeed, the selection of the codon boxes that are "split" is determined by the very same stereochemistry that underlies which of the mismatches in the second position are susceptible to the failed rejection problem. The observed symmetry is thus not arbitrary.

Encrypted Stop Signs

Another astonishing feature of the genetic code is that the sequences of stop codons overlap with those of the codons specifying the most abundant amino acids. This means that the genetic code is set up in such a way to dampen the impact of frameshift mutations. A frameshift mutation occurs as the result of indels (insertions or deletions) of a number of nucleotides that is non-divisible by three. Such an event causes the reading frame to be shifted, resulting in the production and accumulation of misfolded proteins. The earlier on in the sequence that this indel occurs, the greater the alteration of the protein's amino-acid sequence.

The genetic code is thought of as being comprised of groups of four codons where the first positions are the same for all four (whereas the third can be occupied by any base). When codons code for the same amino acid, they are referred to as a "codon family." Half of the genetic code is comprised from such codon families. In the codon families designated AAN and AGN (which categorize Asn/Lys and Ser/Arg triplets respectively), the triplets overlap with the UAA and UAG stop codons which terminate translation. These encrypted stop signs help to prevent the accumulation of misfolded proteins.

As Bollenbach et al. (2007) explain,

...stop codons can easily be concealed within a sequence. For example, the UGA stop codon is only one frameshift away from NNU|GAN; the GAN codons encode Asp and Glu, which are very common in protein sequences. Similarly, UAA and UAG can be frameshifted to give NNU|AAN and NNU|AGN (the AAN codons encode Asn or Lys and AGN gives Ser or Arg). Glu, Lys, Asp, Ser, and Arg are relatively common amino acids in the genome, so the probability of a stop codon arising from a misread of a codon from one of these three amino acids is very high. The fact that a stop codon can be "hidden" in this way using a frameshift means that even a signal sequence that happens to include a stop codon (a problem that is bound to arise sooner or later) can be encoded within the protein sequence by using one of the two reading frames in which the stop codon encodes for a frequently used amino acid.
Remarkably, the 64-to-20 mapping system is set up in order to minimize the number of amino acids that are translated from a frameshifted transcript before the appearance of one of the stop codons. Highly frequent codons (e.g. those coding for aspartic or glutamic acid) can frequently form stop codons in the event of a frame shift. Thus, in the conventional genetic code, translation of a frameshift error is halted faster on average than in 99.3% of alternative codes (Itzkovitz and Alon, 2007).
Related to this is the ability, also reported by Itzkovitz and Alon, of the universal genetic code to "allow arbitrary sequences of nucleotides within coding sequences much better than the vast majority of other possible genetic codes." They report,

We find that the universal genetic code can allow arbitrary sequences of nucleotides within coding regions much better than the vast majority of other possible genetic codes. We further find that the ability to support parallel codes is strongly correlated with an additional property -- minimization of the effects of frameshift translation errors.
The genetic code is thus highly optimized for encoding additional information beyond the amino acid sequence in protein-coding sequences. Examples include RNA splicing signals and information about where nucleosomes should be positioned on the DNA, as well as sequences for RNA secondary structure.
Nature's Alphabet is Non-Random

Philip and Freeland (2011) take this theme to an even deeper level, suggesting that the set of 20 amino acids used in nature is fundamentally non-random. The authors compared the coverage of the standard alphabet of 20 amino acids for "size, charge, and hydrophobicity with equivalent values calculated for a sample of 1 million alternative sets (each also comprising 20 members) drawn randomly from the pool of 50 plausible prebiotic candidates."

The authors report that,

...the standard alphabet exhibits better coverage (i.e., greater breadth and greater evenness) than any random set for each of size, charge, and hydrophobicity, and for all combinations thereof. In other words, within the boundaries of our assumptions, the full set of 20 genetically encoded amino acids matches our hypothesized adaptive criterion relative to anything that chance could have assembled from what was available prebiotically.
The authors are thus quick to dismiss the chance hypothesis as a non-viable option. The significance of this extends further, for the researchers also go after the eight prebiotically plausible amino acids that are found among the 20 that are currently exhibited in biological proteins. They compared the properties of these amino acids with alternative sets of eight drawn randomly, establishing -- once again -- the fundamentally non-random nature of those utilized.
The Non-Evolvability of the Genetic Code

Changes in codon assignments would be catastrophic to the cell because such a mutation would ultimately lead to changes to the amino acid sequence in every protein produced by the cell. This means that one cannot have a significantly evolving genetic code, though -- it may be granted -- there are one or two minor variations on the standard genetic code. Some have tried to argue around this by positing that the lesser-used codons can be redesignated to a different but related amino acid, thus allowing the genetic code to become optimized. There are, however, significant difficulties with this proposal. For one thing, it seems highly unlikely that by virtue of replacing some of the lesser-used amino acid assignments with a related amino acid that one could attain the level of optimization which we find in the conventional code.

Furthermore, the question is naturally raised as to what selective-utility would be exhibited by the new amino acids. Indeed, they would have no utility until incorporated into proteins. But that won't happen until they are incorporated into the genetic code. And thus they must be synthesized by enzymes that lack them. And let us not forget the necessity for the dedicated tRNAs and activating enzymes which are needed for including them in the code.

One related difficulty with standard evolutionary explanations is that a pool of biotic amino acids substantially less than 20 is liable to substantially reduce the variability of proteins synthesized by the ribosomes. And prebiotic selection is unlikely to sift the variational grist for this trait of amino-acid-optimality prior to the origin of self-replicative life (in many respects, "prebiotic selection" is somewhat oxymoronic).

There is also the added problem of the potential for codon mapping ambiguity. If, say, 80% of the time a particular codon specifies one amino acid and 20% of the time specifies another, this mapping ambiguity would lead to cellular chaos.

For a thorough discursive review of various attempts at explaining code evolution, I refer readers to this 2009 paper by Eugene Koonin and Artem Novozhilov. They conclude their critical review by lamenting that,

In our opinion, despite extensive and, in many cases, elaborate attempts to model code optimization, ingenious theorizing along the lines of the coevolution theory, and considerable experimentation, very little definitive progress has been made.
They further report,

Summarizing the state of the art in the study of the code evolution, we cannot escape considerable skepticism. It seems that the two-pronged fundamental question: "why is the genetic code the way it is and how did it come to be?," that was asked over 50 years ago, at the dawn of molecular biology, might remain pertinent even in another 50 years. Our consolation is that we cannot think of a more fundamental problem in biology.
Nonetheless, even if we grant the premise that the genetic code can be modified over time, it still remains to be determined whether there are sufficient probabilistic resources at hand to justify appeals to the workings of chance and necessity. In view of the sheer number of codes that would need to be sampled and evaluated, evolutionary scenarios seem quite unlikely.

Doing the Math

Hubert Yockey, a biophysicist and information theorist, has argued that the number of potential genetic codes is of the order of 1.40 x 10^70. Yockey concedes the extremely conservative figure of 6.3 x 10^15 seconds for the time available for the genetic code to evolve. Note that this assumes that the genetic code has been evolving since the Big Bang. So, how many codes per second would be required to be evaluated in order for natural selection to "stumble upon" the universal genetic code found in nature? The math works out to roughly 10^55 codes per second.

Think about that. Even granting such absurd estimates -- all the time available since the Big Bang -- natural selection would be required to evaluate 10^55 genetic codes per second in order to have a reasonable chance of stumbling across the optimized genetic code found in nature. This treacherous hurdle is accentuated when one considers more reasonable estimates. The earth likely became bio-habitable about 3.85 billion years ago, with signs of the first life appearing around 3.8 billion years ago. More realistic estimates for the time available make the problem only more daunting. For further discussion of this, see biochemist Fazale Rana's book, The Cell's Design.

Overlapping Codons and Ribosomal Frameshifting

ribosomal frameshift signal.jpgA further remarkable design feature of the genetic code is its ability to have overlapping reading frames such that two or more proteins can be produced from the same transcript. This phenomenon is known as "ribosomal frameshifting", and is commonly found in viruses including barley yellow dwarf virus, potato leafroll virus and simian retrovirus-1.

Ribosomal frameshifting is promoted by a pseudoknot structure (shown in the diagram) and also a specific site in the mRNA, known as a slippery sequence which normally contains several adenine residues. When this occurs, the ribosome shifts back one base and subsequently proceeds to read the mRNA transcript in a different frame. This allows two or more different proteins to be produced from the same transcript!

As mentioned, this programmed ribosomal frameshifting is particularly prevalent in viruses, where the genome must be small because of the small volume of the viral capsid).

It is now known that ribosomal frameshifting occurs in all three of life's domains. One example of such in eukaryotic cells comes from the yeast Saccaromyces cerevisiae, in which this process produces the proteins Est3p and Abp140p.

Conclusion

In light of facts such as the above, it is becoming increasingly clear that the genome is bidirectional, multifaceted and interleaved at every tie. Unguided chance/necessity mechanisms are demonstrably inadequate in accounting for this engineering marvel. Such delicately balanced and finely tuned parameters are routinely associated with purposive agents. Agents are uniquely endowed with the capacity of foresight, and have the ability to visualize and subsequently actualize a complex end point. If, in every other realm of human experience, such features are routinely associated with intelligent causes -- and only intelligent causes -- are we not justified in positing that this system also originated at the will of a purposive and conscious agent?



Last edited by Admin on Thu Mar 30, 2017 6:21 am; edited 1 time in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Heinrich Ferreira

http://www.chemguide.co.uk/organicprops/aminoacids/dna5.html

(Here is an updated version with the links fixed)

I am reading a book on DNA and found out something interesting I want to share with you as it is just amazing to me as a programmer. Each of our chromosomes contains "computer code"/assembly instructions which are passed on to a machine in our cells called a Ribosome. This machine is capable of following the instructions in the code to the letter in order to manufacture any one of thousands of protein molecules. All of these protein molecules are built up from any of 20 amino acid molecules which are the same "lego blocks" used in all animals and plants used to construct important proteins like the hormone Insulin for example. The code programmed into DNA works like a telegram. There are 4 possible letters (A,G,C,T). These letters are found in an exact sequence in the strands of your DNA. In order to construct a protein the letters are read by an enzyme protein machine called RNA polimerase in groups of 3 letters at a time to indicate which amino acid molecule must be linked next into the chain in order to reproduce the protein. The exact sequence of amino acids determines the function of the protein, enzyme of hormone. These groups of 3 letters are called a codon and make up the alphabet of your life): eg. "ATG" (is used to signal the start of a protein, as well as an amino acid of its own) and the words ( "TAA", "TAG", "TGA") signal the stop of a protein, in a similar fashion that the "STOP" used to be used in a telegram to indicate where words start and end. In each one of us, the same sentence of DNA words will always produce the same protein. There is also error correction built into the DNA code, meaning that for each word of 3 letters (with possibilities of A,G,C,T) there are therefore (4x4x4=64 possible words which can be made up from these 4 letters) These 64 words are mapped to 20 possible amino acids and a START and STOP punctuation. This means there are on average 64/21 = 3.05 words which triggers the inclusion of each amino acid into the "printed protein product" This means that if there are single letter mutations/changes/errors, it will possibly still map to the same amino acid in the sequence and therefore not result in a useless protein molecule due to incorrect amino acids in the sequence, but slightly changed sequences might still map to the same protein.

I wrote a small computer program to check this out and mapped the letters to amino acids and back.

Here is the sequence embedded near the start of Chromosome 11 to encode Insulin (without which you get Diabetes):
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTT
GTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTAC
ACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGC
AGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGC
TCCCTCTACCAGCTGGAGAACTACTGCAACTAG

You can see it on the Human Genome Website:

http://Feb2014.archive.ensembl.org/Homo_s…/Transcript/Exons…

When your Ribosome decodes this "words", it will create an Amino Acid sequence by picking the correct amino acid if it has that specific one "in stock" (each of the 3 letter abbreviations points to a different amino acid according to a fixed lookup table)
Met-Ala-Leu-Trp-Met-Arg-Leu-Leu-Pro-Leu-Leu-Ala-Leu-Leu-Ala-Leu-Trp-Gly-Pro-Asp-Pro-Ala-Ala-Ala-Phe- Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr- Thr-Pro-Lys-Thr-Arg-Arg-Glu-Ala-Glu-Asp-Leu-Gln-Val-Gly-Gln-Val-Glu-Leu-Gly-Gly-Gly-Pro-Gly-Ala-Gly- Ser-Leu-Gln-Pro-Leu-Ala-Leu-Glu-Gly-Ser-Leu-Gln-Lys-Arg-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys- Ser-Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-STOP

Written out it is actually:

Methionine-Alanine-Leucine-Tryptophan-Methionine-Arginine-Leucine-Leucine-Proline-Leucine-Leucine-Alanine-Leucine-Leucine-Alanine-Leucine-Tryptophan-Glycine-Proline-Aspartic acid-Proline-Alanine-Alanine-Alanine-Phenylalanine-Valine-Asparagine-Glutamine-Histidine-Leucine-Cysteine-Glycine-Serine-Histidine-Leucine-Valine-Glutamic acid-Alanine-Leucine-Tyrosine-Leucine-Valine-Cysteine-Glycine-Glutamic acid-Arginine-Glycine-Phenylalanine-Phenylalanine-Tyrosine-Threonine-Proline-Lysine-Threonine-Arginine-Arginine-Glutamic acid-Alanine-Glutamic acid-Aspartic acid-Leucine-Glutamine-Valine-Glycine-Glutamine-Valine-Glutamic acid-Leucine-Glycine-Glycine-Glycine-Proline-Glycine-Alanine-Glycine-Serine-Leucine-Glutamine-Proline-Leucine-Alanine-Leucine-Glutamic acid-Glycine-Serine-Leucine-Glutamine-Lysine-Arginine-Glycine-Isoleucine-Valine-Glutamic acid-Glutamine-Cysteine-Cysteine-Threonine-Serine-Isoleucine-Cysteine-Serine-Leucine-Tyrosine-Glutamine-Leucine-Glutamic acid-Asparagine-Tyrosine-Cysteine-Asparagine-Stop

Notice the start word:ATG

and the end word: TGC

These words tell the Ribosome machine where to "cut" the completed protein off from its production line conveyor belt when it has finished "printing" the molecule. There are therefore START AND STOP letters in exactly the same way as modems use START and STOP bits for transmission, as well as redundancy for error correction. (I have even found there are logical operators and "synchronisation sequences" called promotors to which the enzyme, which unzips the DNA mulecule, can bind) The double helix DNA molecule is "unzipped" for about 10 letters at a time and a copy is made into the messenger RNA which will go to the Ribosome factory. It then zips the DNA back again when it is finished.

This is how Insulin is produced...your Ribosome molecular machine, stringing the amino acids together in the exact sequence as described in the "telegram", sent to it as mRNA (messenger RNA which passed from inside the nucleus where your body program is stored) Here is a 3D model of the molecule: http://proteopedia.org/wiki/index.php/1aph

You can have a look at the exact WORD-Amino acid mapping here:

http://en.wikipedia.org/wiki/Genetic_code

http://www.chemguide.co.uk/organicprops/aminoacids/dna5.html

All the DNA "computer code" needed to produce every cell in your body is contained in 46 chromosomes of about 5 nm long each. There are about 1.5 Gigabytes of information stored in the DNA of each of your cells. These are the words, you can say, that was uttered when the first human's cells were "spoken" into existence. The cells of each of us starts from a few cells when we are an embryo and this same "words" of information gets faithfully copied for each of the billions and billions of cells that you are made of. When mutations or errors do happen, then protein machines (for which the code is also stored in the DNA) repair the damage by cutting out a certain region around the damaged part and fixes it up by using a duplicate backup copy of this protein's blueprint (its gene) located on another part of the same DNA strand or on another chromosome coming from your other parent....is this not amazing: And it happens for up to 20000 letters of code per day.
See how it works at:

http://users.rcn.com/jkimball.ma.ultranet/…/D/DNArepair.html



Last edited by Admin on Mon Jan 23, 2017 3:48 am; edited 1 time in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
The origin of the genetic cipher, the most perplexing problem in biology

http://reasonandscience.heavenforum.org/t2057-origin-of-translation-of-the-4-nucleic-acid-bases-and-the-20-amino-acids-and-the-universal-assignment-of-codons-to-amino-acids#4596



A review of Paul Davies book, the fifth miracle, about the genetic code. Starting at page 105:

I have described life as a deal struck between nucleic acids and proteins. However, these molecules inhabit very different chemical realms; indeed, they are barely on speaking terms. This is most clearly reflected in the arithmetic of information transfer. The data needed to assemble proteins are stored in DNA using the four-letter alphabet A, G, C, T. On the other hand, proteins are made out of twenty different sorts of amino acids. Obviously twenty into four won’t go. So how do nucleic acids and proteins communicate?
Earthlife has discovered a neat solution to this numerical mismatch by packaging the bases in triplets.

How could earthlife have discoverd a mechanism upon which life depends ? 

Four bases can be arranged in sixty-four different permutations of three, and twenty will go into sixty-four, with some room left over for redundancy and punctuation. The sequence of rungs of the DNA ladder thus determines, three by three, the exact sequence of amino acids in the proteins. To translate from the sixty-four triplets into the twenty amino acids means assigning each triplet (termed a codon) a corresponding amino acid. This assignment is called the genetic code. The idea that life uses a cipher was first suggested in the early 1950s by George Gamow, the same physicist who proposed the modern big-bang theory of the universe. As in all translations, there must be someone, or something, that is bilingual, in this case to turn the coded instructions written in nucleicacid language into a result written in amino-acid language. From what I have explained, it should be apparent that this crucial translation step occurs in living organisms when the appropriate amino acids are attached to the respective molecules of tRNA prior to the protein-assembly process.  This attachment is carried out by a group of clever enzymes  


cleverness is something we do usually assign to someone that is intelligent

that recognize both RNA sequences and the different amino acids, and marry them up accordingly with the right designation. 

The recognition must be PRE-PROGRAMMED. In the same manner, as a translator must learn two languages, in order to be able to assign one written word in english,  for example, to the written symbol in chinese with the same significance. There must be a previous common agreement of meaning before the translation process can begin. As for example, the word  translator, is written 翻譯者 in traditional chinese. Ask someone that does not speak chinese, to translate the word translator  into chinese . He has around 3500 different symbols to chose from. In the " amino acid language", there are 20 different amino acids to chose from.  The translator must know both, the word translator in english and in chinese, and know both written alphabets, previous to make the assignment. Only mental processes are able to do this. Chance is simply a impotent cause. 


William Dembsky:
http://www.discovery.org/a/1256
The problem is that nature has too many options and without design couldn’t sort through all those options. The problem is that natural mechanisms are too unspecific to determine any particular outcome. Natural processes could theoretically form a protein, but also compatible with the formation of a plethora of other molecular assemblages, most of which have no biological significance. Nature allows them full freedom of arrangement. Yet it’s precisely that freedom that makes nature unable to account for specified outcomes of small probability.Nature, in this case, rather than being intent on doing only one thing, is open to doing any number of things. Yet when one of those things is a highly improbable specified event, design becomes the more compelling, better  inference. Occam's razor also boils down to an argument from ignorance: in the absence of better information, you use a heuristic to accept one hypothesis over the other.



The genetic code, with a few recently discovered minor variations, is common to all known forms of life. That the code is universal is extremely significant, for it suggests it was used by the common ancestor of all life, and is robust enough to have survived through billions of years of evolution. Without it, the production of proteins would be a hopelessly hit-or-miss affair. Questions abound. How did such a complicated and specific system as the genetic code arise in the first place? Why, out of the 10 possible codes based on triplets, has nature chosen the one in universal use? Could a different code work as well? If there is life on Mars, will it have the same genetic code as Earthlife? Can we imagine uncoded life, in which interdependent molecules deal directly with each other on the basis of their chemical affinities alone? Or is the origin of the genetic code itself (or at least a genetic code) the key to the origin of life? The British biologist John Maynard Smith has described the origin of the code as the most perplexing problem in evolutionary biology. With collaborator Eörs Szathmáry he writes: “The existing translational machinery is at the same time so complex, so universal, and so essential that it is hard to see how it could have come into existence, or how life could have existed without it.” To get some idea of why the code is such an enigma, consider whether there is anything special about the numbers involved. Why does life use twenty amino acids and four nucleotide bases? It would be far simpler to employ, say, sixteen amino acids and package the four bases into doublets rather than triplets. Easier still would be to have just two bases and use a binary code, like a computer. If a simpler system had evolved, it is hard to see how the more complicated triplet code would ever take over. The answer could be a case of “It was a good idea at the time.” A good idea of whom ?  If the code evolved at a very early stage in the history of life, perhaps even during its prebiotic phase, the numbers four and twenty may have been the best way to go for chemical reasons relevant at that stage. Life simply got stuck with these numbers thereafter, their original purpose lost. Or perhaps the use of four and twenty is the optimum way to do it. There is an advantage in life’s employing many varieties of amino acid, because they can be strung together in more ways to offer a wider selection of proteins. But there is also a price: with increasing numbers of amino acids, the risk of translation errors grows. With too many amino acids around, there would be a greater likelihood that the wrong one would be hooked onto the protein chain. So maybe twenty is a good compromise. Do random chemical reactions have knowledge to arrive at a optimal conclusion, or a " good compromise" ?  

An even tougher problem concerns the coding assignments—i.e., which triplets code for which amino acids. How did these designations come about? Because nucleic-acid bases and amino acids don’t recognize each other directly, but have to deal via chemical intermediaries, there is no obvious reason why particular triplets should go with particular amino acids. Other translations are conceivable. Coded instructions are a good idea, but the actual code seems to be pretty arbitrary. Perhaps it is simply a frozen accident, a random choice that just locked itself in, with no deeper significance. 

And how could that make sense ? THINK !! 

On the other hand, there may be some subtle reason why this particular code works best. If one code had the edge over another, reliability-wise, then evolution would favor it

The problem once more is, that evolution could not be in play at this time and stage of affairs, since evolution only works upon replication. Replication depends on the machinery in question. Catch22.... 

, and, by a process of successive refinement, an optimal code would be reached. It seems reasonable.

DOES IT SEEM REASONABLE ? TO ME IT SEEMS UTMOST IRRATIONAL. IRRATIONAL TO THE EXTREME. So did random , unguided, non-intelligent chemicals have a pre-established goal to reach a optimal code? And even if that were the case, what good would it be without the translation machinery, the ribosome, fully set up aind in place, and doing its job ? 

But this theory is not without problems either. Darwinian evolution works in incremental steps, accumulating small advantages over many generations. In the case of the code, this won’t do. Changing even a single assignment would normally prove lethal, because it alters not merely one but a whole set of proteins. Among these are the proteins that activate and facilitate the translation process itself. So a change in the code risks feeding back into the very translation machinery that implements it, leading to a catastrophic feedback of errors that would wreck the whole process. To have accurate translation, the cell must first translate accurately. This conclusion seems paradoxical. A possible resolution has been suggested by Carl Woese. He thinks the code assignments and the translation mechanism evolved together. Initially there was only a rough-and-ready code, and the translation process was very sloppy. At this early stage, which is likely to have involved less than the present complement of twenty amino acids, organisms had to make do with very inefficient enzymes: the highly specific and refined enzymes life uses today had not yet evolved. Obviously some coding assignments would prove better than others, and any organism that employed the least error-prone assignments to code for its most important enzymes would be on to a winner.

Since when does dead matter have the intrinsic desire to get alive, and to win ? 

It would replicate more accurately, and in the process its coding arrangements would predominate among daughter cells. In this context, a “better” coding assignment would mean a robust one, so that, if there was a translation error, the same amino acid would nevertheless be made—i.e., there would be enough ambiguity for the error to make no difference. Or, in case the error did cause a different amino acid to be made, it would be a close cousin of the intended one, and the resulting protein would do the job almost as well. Successive refinements of this process might then lead to the universal code seen today—like a picture gradually coming into focus.

Now THAT was a great lecture of how to do pseudo-science, and assign to chance creative power that it does not have. 

The code may have an altogether deeper explanation. If a table of coding assignments is drawn up, it can be analyzed mathematically to see if there are any hidden patterns. Peter Jarvis and his colleagues at the University of Tasmania claim that the universal code conceals abstract sequences similar to the energy levels of atomic nuclei, and might even involve a subtle property of subatomic particles called supersymmetry. These mathematical correspondences may be purely coincidental, or they may point to some underlying connection between the physics of the molecules involved and the organization of the code.
I have subjected the reader to the technicalities of the genetic code to make a general conceptual point that goes right to the heart of the mystery of life. Any coded input is merely a jumble of useless data unless an interpreter or a key is available. A coded message is only as good as the context in which it is put to use. That is to say, it has to mean something. In chapter 2, I drew the distinction between syntactic and semantic information. On their own, genetic data are mere syntax. The striking utility of encoded genetic information stems from the fact that amino acids “understand” it. The information distributed along a strand of DNA is biologically relevant. In computerspeak, genetic data are semantic data. For a clear perspective on this point, consider the way in which the four bases A, G, C, and T are arranged in DNA. As explained, these sequences are like letters in an alphabet, and the letters may spell out, in code, the instructions for making proteins. A different sequence of letters would almost certainly be biologically useless. Only a very tiny fraction of all possible sequences spells out a biologically meaningful message, in the same way that only certain very special sequences of letters and words constitute a meaningful book. Another way of expressing this is to say that genes and proteins require exceedingly high degrees of specificity in their structure. As I stated in my list of properties in chapter 1, living organisms are mysterious not for their complexity per se, but for their tightly specified complexity. To comprehend fully how life arose from nonlife, we need to know not only how biological information was concentrated, but also how biologically useful information came to be specified, given that the milieu from which the first organism emerged was presumably just a random mix of molecular building blocks. In short, how did meaningful information emerge spontaneously from incoherent junk?

I began this section by stressing the dual nature of biomolecules: they can be both hardware— particular three-dimensional forms—and software. The genetic code shows just how important the informational aspect of biomolecules is. The job of explaining the origin of life goes beyond finding a plausible chemical pathway out of a primordial soup. We need to know, conceptually, how mere hardware can give rise to software.



Last edited by Admin on Thu Jan 14, 2016 10:36 am; edited 8 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Getting the message


I am writing this book on an old-fashioned Macintosh Classic computer, with a small screen and an intriguing habit of choosing its own tab setting. Like most computers, my Mac is made mainly from plastic, but the crucial innards consist of metal and semiconductors. Together with the wires, circuit boards, and glass screen, this constitutes the computer hardware. The machine is useless, however, without the software that instructs it on what to do. Mostly the software comes loaded on floppy disks. Of course the disks are also hardware, but it is the information encoded on their surfaces that matters, information to be read off by the machine. Once the right software is combined with the appropriate hardware, one is in business. The program may then be run. Life is very much like that. A living cell is made largely of proteins. This is the hardware. The membrane surrounding the cell is analogous to the plastic shell of my computer, or, perhaps more accurately, to the microchip substrate onto which the circuitry is etched. It’s no good, however, just throwing a heap of proteins into a container and expecting life to happen. Even with the necessary raw materials, a cell won’t do anything clever without software. This is normally provided by DNA. Like the floppy disk, DNA is itself hardware, but again the crucial feature is not the stuff of which DNA is made but the message written into its base pairs. Put this message into the right molecular environment—in the right semantic context—and, what do you know, life happens!

So life is a felicitous blend of hardware and software. More than mere complexity, it is informed or instructed complexity. Let me illustrate this subtle but absolutely crucial point with a couple of analogies. The nineteenth century was the great Age of the Machine. Many clever devices were invented. Take, for example, the steam-engine governor, a pair of balls attached to levers that rotate at a rate determined by the steam pressure. If the pressure gets too high, the balls whirl so fast that, by centrifugal force, they lever a valve open, thereby reducing the pressure. Today we would describe the principle behind this type of mechanism as “feedback.” You wouldn’t do it with balls any more. Instead, a sensor would feed data about the pressure electrically to a small computer or microprocessor. This electronic system would then process the information and instruct the valve to open or close using a motor. My wife’s Holden Berina car has one of these microprocessors to maximize fuel efficiency.

It decides how fast the engine should run when it is idling. The difference between the push-pull mechanical steam governor and the electronic microprocessor is that the former is a hardware solution to a problem and the latter depends on information processing and software, i.e., it is “digital.” The power of software is that it can act as an interface between chalk and cheese—different sorts of hardware that otherwise could not deal with each other effectively. Compare the difficulty of trying to steer a kite with the ease of flying a model aircraft by remote control. The difference here reduces to hardware versus software. The pull of the kite strings is a direct but very clumsy way of coupling the kite hardware to the control hardware (the person on the ground). The radio system, which first encodes the instructions and then relays the coded data to be interpreted at the other end, works much more efficiently. Of course, the informational flow from ground to aircraft may also be described in hardware terms: radio waves propagate from the transmitter to the receiver, where they induce an electric current that triggers circuits and moves airfoils, etc. However, this hardware description is merely incidental to the performance of the plane. The role of the radio waves is simply to serve as an information channel. The waves themselves don’t push and pull the aircraft about. Instead, the coded information harnesses other, more powerful, forces to do the job.



Last edited by Admin on Tue Jan 03, 2017 5:23 pm; edited 1 time in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
The Logic of Chance: The Nature and Origin of Biological Evolution, Eugene V. Koonin, page 367:

The nature and origin of the genetic code.
To understand how translation might have emerged, the nature and origin of the codon assignments in the universal genetic code are crucial. The evolution of the code fascinated researchers even before the code was fully deciphered, and the earliest treatises on the subject already clearly recognized three not necessarily mutually exclusive evolutionary models: (i) steric complementarity resulting in specific interactions between amino acids and the cognate codon or anticodon triplets, (ii) “frozen accident,” fixation of a random code that would have been virtually impossible to significantly change afterward, and (iii) adaptive evolution of the code starting from an initially random codon assignment (Crick, 1968). The structure of the code is clearly nonrandom: Codons for related amino acids are mostly adjacent in the code table, resulting in a high (although not maximum) robustness of the code to mutations and translation errors, as Woese first noticed (Woese, 1967) and Stephen Freeland and Laurence Hurst subsequently demonstrated quantitatively (Freeland and Hurst, 1998). The robustness of the code falsifies the frozen accident scenario in its extreme form (random assignment of codons without any subsequent evolution); however, the stereochemical model, the selection model, a combination thereof, or frozen accident followed by adaptation all could, in principle, explain the observed properties of the code (Koonin and Novozhilov, 2009).

The main dilemma is whether a stereochemical correspondence between amino acids and cognate triplets exists. The answer to this seemingly simple question proved to be surprisingly elusive. The early attempts to establish specificity in the interactions of (poly)amino acids and polynucleotides have been inconclusive, indicating that, if a specific affinity exists, it must be much less than precise, and the interactions involved would be weak and dependent on extraneous factors. Although some tantalizing nonrandomness in amino acid–oligonucleotide interactions has been claimed, in general, the attempts to demonstrate such interactions directly have failed (Saxinger and Ponnamperuma, 1974).

The origin of translation:
The key ideas and models During the 40 years since the discovery of the translation mechanism and deciphering of the genetic code, numerous theoretical (inevitably, speculative, sometimes far-fetched, often highly ingenious) models of the origin and evolution of various components of the translation apparatus and different aspects of the translation process have been proposed. It is unrealistic to provide here a thorough critical review of these models. Instead, I consider a few central ideas that are germane to the thinking about the origin of translation and then discuss in somewhat greater detail the only two coherent scenarios I am aware of. The main general point about the evolution of translation is that selection for protein synthesis could not have been the underlying cause behind the origin of the translation system. To evolve this complex system via the Darwinian route, numerous steps are required, but proteins appear only at the last steps; until that point, an evolving organism “does not know” how good proteins could be.

The emergence of the complex translation machinery by random drift is not practical either—at least, not within the regular framework of evolutionary biology. Thus, the only conceivable route for the emergence of translation
seems to be exaptation: Intermediate stages in the evolution of the translation system must have been selected for functions other than protein synthesis. Different scenarios for the origin of translation started with different speculations on the nature of the exapted function.

A skeptical summary of the existing models for the evolution of replication and translation
In the preceding sections, we outlined the status of the RNA World and discussed the origins of replication and translation in some detail. Let us now ask a simple, straightforward question: Is the evidence in support of any of these models and scenarios compelling? Of course, the question already implies a negative answer. We do have some strong hints, even if these are a far cry from a coherent scenario of the earliest stages of evolution of biological information transmission. First, consider the apparent logical inevitability of an RNA World: What other starting point for the evolution of the translation system could there be? Second, comparative analysis of the translation system components does point to a much greater role of RNA in ancestral translation, compared to the modern system—notably, the decisive function of RNA as the determinant of amino acid–codon specificity. Third, ribozymes are impressive (if in general far inferior to proteins) in their catalytic versatility and efficiency. Thirty years ago, no catalytic activity was reported for any RNA molecule to catalyze any reaction at all; now we are aware of dozens of ribozyme activities, including some, such as highly efficient aminoacylation, that get the translation system going.

However, this is about all the good news; the rest is more like a sobering cold shower. For all the advances of “ribozymology,” no ribozyme polymerase comes close to what is required if we are to accept an RNA-only replicator system as a key intermediate stage in the evolution of life. Nor are any ribozymes capable of catalyzing the synthesis of nucleotides or even their sugar moieties. Even sweeping all these problems under the proverbial rug, the path from a putative RNA World to the translation system is incredibly steep. The general idea of a function(s) for abiogenic amino acids and possibly peptides in the RNA World, such as the role of ribozyme cofactors (see the discussion in the preceding sections), appears fruitful and is compatible with experimental data. Nevertheless, breaking the evolution of the translation system into incremental steps, each associated with a biologically plausible selective advantage, is extremely difficult even within a speculative scheme let alone experimentally.

View user profile http://elshamah.heavenforum.com

Sponsored content


View previous topic View next topic Back to top  Message [Page 1 of 1]

Permissions in this forum:
You cannot reply to topics in this forum