Intelligent Design, the best explanation of Origins

This is my personal virtual library, where i collect information, which leads in my view to Intelligent Design as the best explanation of the origin of the physical Universe, life, and biodiversity


You are not connected. Please login or register

Intelligent Design, the best explanation of Origins » Origin of life » Molecular biochemistry, and the origin of life and biodiversity, examined from a holistic methodological perspective

Molecular biochemistry, and the origin of life and biodiversity, examined from a holistic methodological perspective

View previous topic View next topic Go down  Message [Page 1 of 1]

Admin


Admin
Molecular biochemistry, and the origin of life and biodiversity,  examined from a holistic methodological perspective

This book aims to distinguish itself from other books on biochemistry based on the philosophical framework of methodological naturalism. The author starts with the admission that both possible causal mechanisms of origins, intelligent and mental, and natural ( non-intelligent ) deserve to be scrutinized, tested, elucidated and analyzed, in order to find the best, case-adequate answers of origins. In this book, we will analyze how information-based molecular machines, metabolic networks, and organisms operate, currently accepted explanations of origins, their shortcomings, and propose eventually intelligent design/divine creation as a better, more compelling explanation of origins.

Historical sciences, and methodological naturalism
Methodological naturalism is necessary for science because science requires that as a precondition of investigating natural things. It is not necessary to elucidate historical facts, however. History does not investigate by empirically determining anything. Although history does seek to answer questions about the past, it requires only that the past is rational. Rational simply means that there is a reason. So if something did happen that was an act of God in the past, then as long as that act had a reason, history can investigate it.

The specific complex information of living systems as, well as fine-tuning agents of a life-permitting universe and immaterial truths have causal materialistic dead ends. However, intelligent design is a current observable mechanism to explain the design, thus are an adequate simple causal mechanism to explain these realities of our universe, its fine tuning improbabilities, information, immaterial abstracts, etc. Intelligence can and is a causal agent in the sciences such as forensics, archeology engineering, etc., thus there is no reason to rule out a priori the unobserved designer scientifically. We only rule him out by philosophical or anti-religious objection, which anybody has the free will right to do, but it isn't necessarily true or right to do so, and we can't use science to do so, if we are unbiased, correctly using the discipline. Additionally, to argue nonempirical causes are inadequate would rule out many would be mainstream secular materialistic hypothetical causes as well. It then becomes a matter of preference to the type of causes one is willing to accept and one's preferred worldview has a lot to do with that. 1

There are basically 3 possible  causing agents of origins and the universe as a whole:

1. Of the universe and the physical laws: an intelligent creator, or random unguided natural events
2. Of the fine-tuning of the universe  and the origin of life: an intelligent creator, random unguided natural events, and physical necessity
3. Of biodiversity: above three, and evolution

Physical necessity is the term that is given to the situation where something is forced to take a certain course of action. Events that are conditioned by some values, forces, laws, norms or goals.  In physics,  the concept of necessity was applied to cases of strict determination and restriction due to so-called causal laws. It's the hypothesis that the constants and quantities had to have the values they do so that the universe and the earth could not take any other course, than the one it did. 1,3
Intelligent design/creation stands for guided, reason based, directed, planned, projected, programmed, information based,  goal-constrained, willed causation by a conscient intelligent powerful eternal, non-caused agency. Chance and evolution could be a included mechanism in the intended goal, but that would in the end still be an intelligence-based process.
Evolution: Biodiversity by evolution through random mutations and natural selection, genetic drift, gene flow, or pre-programmed evolution 

There are only these options.  Either is there an intelligent creator, or there is not. Those are the only options.  If there is no God, then everything is a result of ..... what exactly?
Chance, as exposed above, isn't a thing. Physical necessity could only act once a physical universe exists. Beyond the universe, there were no physical laws.

Once it's granted that nothing has no causal powers, it's evident the universe could not have emerged from absolutely anything. Nobody times nothing equals everything is irrational to the extreme nonetheless, some very "smart" people think that proposition makes sense, and write extensive books about the subject ). Or, behind this complex universe is an incomprehensibly intelligent and powerful eternal being who made everything.

This result means that intelligent design cannot be removed entirely from consideration in the historical sciences. They are a division of history rather than science, and what applies to history, in general, applies to them. However, evidence must be found to support them.

We do not need direct observed empirical evidence to infer design. As anyone who has watched TV's Crime Scene Investigation knows, scientific investigation of a set of data (the data at the scene of a man's death) may lead to the conclusion that the event that produced the data (the death) was not the product of natural causes, not an accident, in other words, but was the product of an intelligence a perpetrator.
But of course, the data at the crime scene usually can't tell us very much about that intelligence. If the data includes fingerprints or DNA that produces a match when cross-checked against other data fingerprint or DNA banks it might lead to the identification of an individual. But even so, the tools of natural science are useless to determine the I.Q. of the intelligence, the efficiency vs. the emotionalism of the intelligence, or the motive of the intelligence. That data, analyzed by only the tools of natural science, often cannot permit the investigator to construct a theory of why the perpetrator acted. Sherlock Holmes can use chemistry to figure out that an intelligence a person did the act that killed the victim, even if he can't use chemistry to figure out that the person who did it was Professor Moriarty, or to figure out why Moriarty did the crime. 
Same when we observe the natural world. It gives us hints about how it could have been created. We do not need to present the act of creation to infer creationism / Intelligent design.

This illustrates why I am against methodological naturalism applied in historical sciences because it teaches us to be satisfied with not permitting the scientific evidence of historical events to lead us wherever it is. Philosophical Naturalism is just one of the possible explanations of  the origin of the universe, it's fine-tuning, has no answer about the origin of life, explains very little about biodiversity, and what it explains, it explains bad, has no explanation about essential questions, like the rise of photosynthesis, sex, conscience, speech, languages, morality. It short: it lacks considerable explaining power,  which attracts so many believers because they think, they do in their life whatever pleases them, no interference from above.

Sean Carroll, in his book The Big Picture: On the Origins of Life, Meaning, and the Universe Itself.

Science should be interested in determining the truth, whatever that truth may be – natural, supernatural, or otherwise. The stance is known as methodological naturalism, while deployed with the best of intentions by supporters of science, amounts to assuming part of the answer ahead of time. If finding truth is our goal, that is just about the biggest mistake we can make.
https://evolutionnews.org/2017/09/intelligent-design-and-methodological-naturalism-no-necessary-contradiction/

Scientific evidence is what we observe in nature. The understanding of it like microbiological systems and processes is the exercise and exploration of science. What we infer through the observation, especially when it comes to the origin of given phenomena in nature, is philosophy, and based on individual induction and abductional reasoning. What looks like a compelling explanation to somebody, cannot be compelling to someone else, and eventually, I infer the exact contrary.

In short, the imposition of methodological naturalism is plainly question-begging, and it is thus an error of method.

PROBABILITY AND SCIENCE
A typical misconception about science is that it can tell us what will definitely happen now or in the future given enough time, or what would certainly have happened in the past, given enough time. The truth is, science is limited in that it does not grant absolute truth, but only yields degrees of probability or likelihood. Science observes the Universe, records evidence, and strives to draw conclusions about what has happened in the past, is happening now, and what will potentially happen in the future, given the current state of scientific knowledge—which is often times woefully incomplete, and even inaccurate. The late, prominent evolutionist George Gaylord Simpson discussed the nature of science and probability several years ago in the classic textbook, Life: An Introduction to Biology, stating:

We speak in terms of “acceptance,” “confidence,” and “probability,” not “proof.” If by proof is meant the establishment of eternal and absolute truth, open to no possible exception or modification, then proof has no place in the natural sciences.

Luke A. Barnes writes:
Theory testing in the physical sciences has been revolutionized in recent decades by Bayesian approaches to probability theory.
Wiki: Bayesian inference is a method of statistical inference in which Bayes' theorem is used to update the probability of a hypothesis as more evidence or information becomes available. Bayesian inference is an important technique in statistics, and especially in mathematical statistics. Bayesian updating is particularly important in the dynamic analysis of a sequence of data. Bayesian inference has found application in a wide range of activities, including science, engineering, philosophy, medicine, sport, and law.  .......and......... historical sciences, including intelligent design theory which tries to explain how most probably past events occurred. That is similar to abductive reasoning :
Wiki: Abductive reasoning is a form of logical inference which goes from an observation to a theory which accounts for the observation, ideally seeking to find the simplest and most likely explanation. In abductive reasoning, unlike in deductive reasoning, the premises do not guarantee the conclusion. One can understand the abductive reasoning as "instant-deduction to the best explanation". 3

No one can know with absolute certainty that the design hypothesis is false.  It follows from the absence of absolute knowledge, that each person should be willing to accept at least the possibility that the design hypothesis is correct, however remote that possibility might seem to him.  Once a person makes that concession, as every honest person must, the game is up.  The question is no longer whether ID is science or non-science.  The question is whether the search for the truth of the matter about the natural world should be structurally biased against a possibly true hypothesis. 4

For, we did not – and cannot -- directly observe the remote past, so origins science theories are in the end attempted “historical” reconstructions of what we think the past may have been like. Such reconstructions are based on investigating which of the possible explanations seems "best" to us on balance in light of the evidence. However, to censor out a class of possible explanations ahead of time through imposing materialism plainly undermines the integrity of this abductive method.

Methodological naturalism is the label for the required assumption of philosophical naturalism when working with the scientific method. Methodological naturalists limit their scientific research to the study of natural causes, because any attempts to define causal relationships with the supernatural are never fruitful, and result in the creation of scientific "dead ends" and God of the gaps-type hypotheses. To avoid these traps scientists assume that all causes are empirical and naturalistic; which means they can be measured, quantified and studied methodically. 5

The first difference is that historical study is a matter of probability. Any and all historical theories are supported by evidence that is not deductive in nature. We might consider them to be inferences to the best explanation, or Bayesian probabilities but they cannot be deductions. historical theories are not based on experiments, – repeatable or otherwise – nor are historical theories subject to empirical verification. The evidence for a historical theory may be empirical, but the theory itself is not. These differences mean that one cannot simply treat science and history as similar disciplines. 6

Stephen Meyer writes: 
Studies in the philosophy of science show that successful explanations in historical sciences such as evolutionary biology need to provide “causally adequate” explanations—that is, explanations that cite a cause or mechanism
capable of producing the effect in question. In On the Origin of Species, Darwin repeatedly attempted to show that his theory satisfied this criterion, which was then called the vera causa (or “true cause”) criterion. In the third chapter of the Origin, for example, he sought to demonstrate the causal adequacy of natural selection by drawing analogies between it and the power of animal breeding and by extrapolating from observed instances of small-scale evolutionary change over short periods of time. 7

Is the mind natural, or supernatural? and what does it tell us about the theory of intelligent design? 



Descartes, the 17th-century philosopher was a dualist, proposing that our consciousness/mind has a separate reality from our body. Is there a God-created soul and spirit and consciousness which exists apart from the body? This is a scientific a philosophical and a religious question. If there are a non-physical soul and spirit, then it might not be detectable by any direct physical measurement, and therefore, it might be, by definition, supernatural. I agree on dualism, based on clinical experiments and testimonies, and philosophy of the mind 9. Since the mind cannot be detected physically, it is a non-physical entity, and does not belong to the realm of the physical world, and is supernatural. 

1. The mind is supernatural 
2  The effects of the mind are natural, physical, tangible, visible, and can be tested scientifically. 

Popper argued that the central property of science is falsifiability. That is, every genuinely scientific claim is capable of being proven false, at least in principle. 

So can the substance of the mind be subject to scientific scrutiny and inquiry? No. 
Can the effects of the mind subject to scientific scrutiny and testing? yes. 

According to Discovery, the theory of intelligent design holds that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection. 10 ID is a scientific theory that employs the methods commonly used by other historical sciences to conclude that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection.  ID theorists argue that design can be inferred by studying the informational properties of natural objects to determine if they bear the type of information that in our experience arise from an intelligent cause. The form of information which we observe is produced by intelligent action, and thus reliably indicates design, is generally called “specified complexity” or “complex and specified information” (CSI). An object or event is complex if it is unlikely, and specified if it matches some independent pattern. 

The U.S. National Academy of Sciences has however stated that "creationism, intelligent design, and other claims of supernatural intervention in the origin of life or of species are not science because they are not testable by the methods of science." 11

So they question the fact, that the action of a supernatural agent cannot be tested by the methods of science. There is, however, a shift of terminology, while Discovery points to the effects of intelligence, and how features in nature point to an intelligent agent, the academy of sciences requires that the intervention, the act per se of creation, should be possible of observation, and testing. And if it does not meet that criterion, it's not science. Is that true? 

The distinction is basically operational x historical sciences. While through operational sciences  following questions can be answered : 

1. What is X (  Elucidating the components and structure )
2. What does Xthe action, how it works, functions, and operates )
3. What is the performance of X ( what is the efficiency etc. )
4. What is the result of the performance of  X  ( the result of the action. )

historical sciences ask: 

5. What is the origin of X ( how did X arise ) 

The action of X can be observed and tested in operational sciences. The action of X, however, cannot be observed directly in historical sciences, since events in the past are in question. 

Proponents of ID are accused of making a false distinction, and there is no such thing as operational x historical science. But Jeff Dodick writes: 

Despite the still-regnant concept of science proceeding by a monolithic “Scientific Method”, philosophers and historians of science are increasingly recognizing that the scientific methodologies of the historical sciences (e.g., geology, paleontology) differ fundamentally from those of the experimental sciences (e.g., physics, chemistry). This new understanding promises to aid education, where currently students are usually limited to the dominant paradigm of the experimental sciences, with little chance to experience the unique retrospective logic of the historical sciences. A clear understanding of these methodological differences and how they are expressed in the practice of the earth sciences is thus essential to developing effective educational curricula that cover the diversity of scientific methods. 10

And Ann Gauger uses the same line of reasoning when she writes:
Defenders of methodological naturalism often invoke definitionally or "demarcation criteria" that say that all science must be observable, testable, falsifiable, predictive, and repeatable. Most philosophers of science now dismiss these criteria because there are too many exceptions to the rules they establish in the actual practice of science. Not all science involves observable entities or repeatable phenomena, for example --you can't watch all causes at work or witness all events happen again and again, yet you can still make inferences about what caused unique or singular events based on the evidence available to you. Historical sciences such as archeology, geology, forensics, and evolutionary biology all infer causal events in the past to explain the occurrence of other events or to explain the evidence we have left behind in the present. For such inference to work, the cause invoked must now be known to produce the effect in question. It's no good proposing flying squirrels as the cause of the Grand Canyon, or a silt deposit as the cause of the Pyramids. Squirrels don't dig giant canyons or even small ones, and silt doesn't move heavy stone blocks into an ordered three-dimensional array. However, we know from our experience that erosion by running water can and does produce gullies, then arroyos, and by extension, canyons. We know that intelligent agents have the necessary design capabilities to envision and build a pyramid. No natural force does. These are inferences based on our present knowledge of cause and effect or "causes now in operation." The theory of intelligent design also qualifies as historical science. We cannot directly observe the cause of the origin of life or repeat the events we study in the history of life, but we can infer what cause is most likely to be responsible, as Stephen Meyer likes to say, "from our repeated and uniform experience." In our experience the only thing capable of causing the origin of digital code or functional information or causal circularity is intelligence and we know that the origin of life and the origin of animal life, for example, required the production of just such things in living systems. Even though other demarcation criteria for distinguishing science from non-science are no longer considered normative for all branches of science, it is worth checking to see how well intelligent design fares using criteria that are relevant for a historical science. Briefly, although the designing agent posited by the theory of intelligent design is not directly observable (as most causal entities posited by historical scientists are not), the theory is testable and makes many discriminating predictions. Steve Meyer's book Signature in the Cell, Chapters 18 and 19 and Appendix A, discuss this thoroughly. 14

We can detect and make a distinction between the patterns and effects of a mind, and compare to the effects of natural causal agencies, physical and chemical reactions and interactions, and draw conclusions upon the results.  That's where ID kicks in, detecting design patterns, and test what is observed in the natural world, to see if they have signs of an intelligent causal agency, and compare the evidence with the efficiency of natural causes, to then, at the end, infer which explanation makes most sense, and fits best the evidence.   So intelligent design does not try to test or to detect or to identify the designer, nor try to detect and test the action of creation, and neither is that required to detect design and infer it as the best explanation of origins,  but examine the natural effects , and upon the results, draw inferences that can provide conclusions of the best explanation model for the most probable origin and cause of the physical parts. So the mere fact that a supernatural agent and its action cannot be scrutinized and observed directly and scientifically, does not disqualify ID as a scientific theory. 

1. Credit to: Steven Guzzi
2. http://www.apologeticspress.org/APContent.aspx?category=12&article=3726
3. https://arxiv.org/pdf/1704.01680.pdf
4. http://iose-gen.blogspot.com.br/2010/06/introduction-and-summary.html#methnat
5. http://rationalwiki.org/wiki/Methodological_naturalism
6. http://simplyphilosophy.org/methodological-naturalism-science-and-history/
7. Darwin's Doubt pg.162:
8. http://reasonandscience.heavenforum.org/t1284-near-death-experience-evidence-of-dualism?highlight=dualism
9. http://reasonandscience.heavenforum.org/t1662-the-mind-is-not-the-brain?highlight=mind
10. http://www.discovery.org/id/faqs/
11. https://en.wikipedia.org/wiki/Intelligent_design_and_science
12. http://evidenceforchristianity.org/is-human-thought-evidence-of-the-supernatural-or-of-the-existence-of-god/
13. http://serc.carleton.edu/files/serc/dodickargamon-f.pdf
14. http://www.evolutionnews.org/2015/11/more_on_the_mec100891.html



Last edited by Admin on Mon Dec 04, 2017 12:51 am; edited 14 times in total

View user profile http://elshamah.heavenforum.com

2 Abiogenesis, and the origin of life on Sun Nov 19, 2017 8:20 am

Admin


Admin
Abiogenesis, and the origin of life

Paul Davies, the Origin of life, page 17:
The problem of how and where life began is one of the great outstanding mysteries of science. But it is more than that. The story of life's origin has ramifications for philosophy and even religion. Answers to such profound questions as whether we are the only sentient beings in the universe, whether life is the product of random accident or deeply rooted law, and whether there may be some sort of ultimate meaning to our existence, hinge on what science can reveal about the formation of life. In a subject supercharged with such significance, lack of agreement is unsurprising. Some scientists regard life as a bizarre chemical freak, unique in the universe, while others insist that it is the expected product of felicitous natural laws. If the magnificent edifice of life is the consequence of a random and purely incidental quirk of fate, as the French biologist Jacques Monod claimed, we must surely find common cause with his bleak atheism, so eloquently expressed in these words:  The ancient covenant is in pieces: man, at last, knows that he is alone in the unfeeling immensity of the universe, out of which he has emerged only by chance. Neither his destiny nor his duty have been written down. But if it transpires that life emerged more or less on cue as part of the deep lawfulness of the cosmos – if it is scripted into the great cosmic drama in a basic manner – it hints at a universe with a purpose. In short, the origin of life is the key to the meaning of life.

Peering into life's innermost workings serves only to deepen the mystery. The living cell is the most complex system of its size known to mankind. Its host of specialized molecules, many found nowhere else but within living material, are themselves already enormously complex. They execute a dance of exquisite fidelity, orchestrated with breathtaking precision. Vastly more elaborate than the most complicated ballet, the dance of life encompasses countless molecular performers in synergetic coordination. Yet this is a dance with no sign of a choreographer. No intelligent supervisor, no mystic force, no conscious controlling agency swings the molecules into place at the right time, chooses the appropriate players, closes the links, uncouples the partners, moves them on. The dance of life is spontaneous, self-sustaining and self-creating. How did something so immensely complicated, so finessed, so exquisitely clever, come into being? How can mindless molecules, capable only of pushing and pulling their immediate neighbors, cooperate to form and sustain something as ingenious as a living organism?

True. There is no sign of a choreographer intervening. Life is self-sustaining, which is evidence of an enormously intelligent creator which setup life, perpetuating autonomously, the way it is.

What is life ?
The National Aeronautics and Space Agency (NASA) of the United States gives an operative definition of life : “Life is a self-sustained chemical system able to undergo Darwinian evolution.” The NASA definition is extensively used in the origins of life field. The NASA definition of life is fully compatible with the following one, structured in more detail: To comprehend the beginnings of life requires that we explain the origin of replication as well as of metabolism synergistically. While metabolism supplies the monomers from which the replicators (i.e., genes) are made, replicators alter the kinds of chemical reactions occurring in metabolism. Only then can natural selection, acting on replicators, power the evolution of metabolism 10

Living things are autopoietic systems: they make themselves. Self-making implies a multitude of activities directed towards the acquisition of matter and energy, production of the fabric, maintenance and repair, and ultimately reproduction. Not surprisingly, even the simplest cells are dauntingly complex systems made up of many thousands of molecules arranged into functional units. Over the past half-century we have become thoroughly familiar with the standard parts found (with variations) in all cells: enzymes and genes, transport systems and scaffolding, ribosomes and membranes, and organs of mobility. We know in general what they do and how they work, and how they contribute to the operations and architecture of the whole cell. By contrast, we know very little about how these devices, or the cell as a whole, came to be. 8 Life’s devices are organelles; they have functions that confer benefits upon the cell or organism as a whole. 

Paul Davies: 1

Reproduction.
Metabolism. 
Nutrition.
Complexity.
Organization. 
Growth and development.
Information content. 
Hardware/software entanglement. 
Permanence and change. 


11

Autonomy is one important characteristic of life. But there are many others, including the following:

Reproduction. A living organism should be able to reproduce. However, some nonliving things, like crystals and bush fires, can reproduce, whereas viruses, which many people would regard as living, are unable to multiply on their own. Mules are certainly living, even though, being sterile, they cannot reproduce. A successful offspring is more than a mere facsimile of the original; it also includes a copy of the replication apparatus. To propagate their genes beyond the next generation, organisms must replicate the means of replication, as well as replicating the genes themselves.

Metabolism. To be considered as properly alive, an organism has to do something. Every organism processes chemicals through complicated sequences of reactions, and as a result garners energy to enable it to carry out tasks, such as movement and reproduction. This chemical processing and energy liberation is called metabolism. However, metabolism cannot be equated with life. Some micro-organisms can become completely dormant for long periods of time, with their vital functions shut down. We would be reluctant to pronounce them dead if it is possible for them to be revived.

Nutrition. This is closely related to metabolism. Seal up a living organism in a box for long enough and in due course it will cease to function and eventually die. Crucial to life is a continual throughput of matter and energy. For example, animals eat, plants photosynthesize. But a flow of matter and energy alone fails to capture the real business of life. The Great Red Spot of Jupiter is a fluid vortex sustained by a flow of matter and energy. Nobody suggests it is alive. In addition, it is not energy as such that life needs, but something like useful, or free, energy. More on this later.

Complexity. All known forms of life are amazingly complex. Even single-celled organisms such as bacteria are veritable beehives of activity involving millions of components. In part, it is this complexity that guarantees the unpredictability of organisms. On the other hand, a hurricane and a galaxy are also very complex. Hurricanes are notoriously unpredictable. Many nonliving physical systems are what scientists call chaotic -- their behavior is too complicated to predict, and may even be random.

Organization. Maybe it is not complexity per se that is significant, but organized complexity. The components of an organism must cooperate with each other or the organism will cease to function as a coherent unity. For example, a set of arteries and veins are not much use without a heart to pump blood through them. A pair of legs will offer little locomotive advantage if each leg moves on its own, without reference to the other. Even within individual cells the degree of cooperation is astonishing. Molecules don't simply career about haphazardly, but show all the hallmarks of a factory assembly line, with a high degree of specialization, a division of labor, and a command-and-control structure.

Growth and development. Individual organisms grow and ecosystems tend to spread (if conditions are right). But many nonliving things grow too (crystals, rust, clouds). A subtler yet altogether more significant property of living things, treated as a class, is development. The remarkable story of life on Earth is one of gradual evolutionary adaptation, as a result of variety and novelty. Variation is the key. It is replication combined with variation that leads to Darwinian evolution. We might consider turning the problem upside down and say: if it evolves in the way Darwin described, it lives.

Information content. In recent years scientists have stressed the analogy between living organisms and computers. Crucially, the information needed to replicate an organism is passed on in the genes from parent to offspring. So life is information technology writ small. But, again, information as such is not enough. Though there is information aplenty in the positions of the fallen leaves in a forest, it doesn't mean anything. To qualify for the description of living, information must be meaningful to the system that receives it: there must be a "context." In other words, the information must be specified. But where does this context itself come from, and how does a meaningful specification arise spontaneously in nature?

Hardware/software entanglement. As we shall see, all life of the sort found on Earth stems from a deal struck between two very different classes of molecules: nucleic acids and proteins. These groups complement each other in terms of their chemical properties, but the contract goes much deeper than that, to the very heart of what is meant by life. Nucleic acids store life's software; the proteins are the real workers and constitute the hardware. The two chemical realms can support each other only because there is a highly specific and refined communication channel between them mediated by a code, the so-called genetic code. This code, and the communication channel -- both advanced products of evolution -- have the effect of entangling the hardware and software aspects of life in a baffling and almost paradoxical manner.

Permanence and change. A further paradox of life concerns the strange conjunction of permanence and change. This ancient puzzle is sometimes referred to by philosophers as the problem of being versus becoming. The job of genes is to replicate, to conserve the genetic message. But without variation, adaptation is impossible and the genes will eventually get snuffed out: adapt or die is the Darwinian imperative. How do conservation and change coexist in one system? This contradiction lies at the heart of biology. Life flourishes on Earth because of the creative tension that exists between these conflicting demands; we still do not fully understand how the game is played out.

What can we know about how life began ? 
Nobody knows for sure. When it comes to historical sciences, nobody was there in the past to see what happened. But upon abductive reasoning, and the growing evidence and knowledge of chemistry, biochemistry, molecular biology, cell biology, evolutionary biology, genetics, epigenetics, and developmental biology, amount of knowledge about how life works, how it have might began and diversified,  is growing. That permits us more than ever before to make informed inferences. My take on abiogenesis is that we can make safe inferences based on what we DO  know.  Douglas Futuyma admits as much:

“Organisms either appeared on the earth fully developed or they did not. If they did not, they must have developed from preexisting species by some process of modification. If they did appear in a fully developed state, they must indeed have been created by some omnipotent intelligence” (Futuyma, 1983, p. 197).

In fact, Futuyma’s words underline a very important truth. He writes that when we look at life on Earth, if we see that life emerges all of a sudden, in its complete and perfect forms, then we have to admit that life was created, and is not a result of chance. As soon as naturalistic explanations are proven to be invalid, then creation is the only explanation left.

chemist Wilhelm Huck, professor at Radboud University Nijmegen
A working cell is more than the sum of its parts. "A functioning cell must be entirely correct at once, in all its complexity

To go from a bacterium to people is less of a step than to go from a mixture of amino acids to a bacterium. — Lynn Margulis. 


History of Origin of Life research 2



How life started on Earth is not known. Although the processes that led to it remain elusive, most explanations suggest that the first forms of life were the evolutionary outcome of a complex mixture of organic compounds of abiotic origin; i.e., the discussion of the origin of life is necessarily a discussion of organic chemistry. Not surprisingly, some of our modern ideas on the origin of life have developed in tandem with discoveries in organic and biochemistry.

In 1805 the German naturalist Lorenz Oken wrote a small booklet titled The Creation, in which stated that “all organic beings originate from and consist of vesicles of cells.” Several decades later the jellylike, water-insoluble substance that was found inside all cells was termed “protoplasm” by the physician Johann E. Purkinje and the botanist Hugo von Mohl, who like others argued that it was the basic physicochemical component of life. 9



In 1828 Friedrich Wöhler demonstrated that heating ammonium cyanate would lead to urea, a result that represented the first synthesis of an organic compound from inorganic starting materials. 

A new era in chemical research had begun: in 1850 Adolph Strecker synthesized alanine in the laboratory from acetaldehyde, ammonia and hydrogen cyanide. This was followed by Butlerov’s demonstration that the treatment of formaldehyde with alkaline catalysts leads to the synthesis of sugars. Since until the 1920’s it was generally assumed that that the first living beings had been autotrophs, the abiotic formation of these organic compounds was not considered a necessary prerequisite for the origin of life. These syntheses were also not conceived of as prebiotic laboratory simulations, but rather as attempts to understand the autotrophic mechanisms of nitrogen assimilation and CO2 fixation in green plants. 

Darwin wrote the now famous letter to his friend Hooker in which the idea of a “warm little pond” was included.

The earliest attempts toward scientific inquiries on this topic can be dated to the 1860s when the discoveries and ideas of such figures as Charles Darwin and Louis Pasteur—on evolution from common descent and spontaneous generation respectively—began to spread among their peers

"But if (and oh what a big if) we could conceive in some warm little pond with all sorts of ammonia and phosphoric salts, light, heat, electricity etcetera present, that a protein compound was chemically formed, ready to undergo still more complex changes [..] "
~Charles Darwin, in a letter to Joseph Hooker (1871)

Although Darwin refrained from any further public statements on how life may have appeared, his views established the framework that would lead to a number of attempts to explain the origin of life by introducing principles of historical explanation.



In a famous lecture delivered at La Sorbonne in 1864, Pasteur not only denied the possibility that inanimate matter could organize itself into living systems, but also stated that “what a victory for materialism if it could be affirmed that it rests on the established fact that matter organizes itself, takes on life itself; matter which has in it already all known forces. Ah! If we could add to it this other force which is called life … what could be more natural than to deify such matter? Of what good would it be then to have recourse to the idea of a primordial creation? To what good the would be the idea of a Creator God?

Regardless of their political ramifications, Pasteur’s results made it difficult to advocate spontaneous generation as an explanation for the ultimate origin of life. As a result, a number of philosophers and naturalists promptly dismissed the study of the origins of life as senseless speculation, whereas the willful distortion of Pasteur’s results by others raised vitalistic expectations once again. Several devoted materialists like Emil du Bois-Reymond, Karl von Nageli, and August Weismann continued to support the idea of spontaneous generation, but others, like Hermann von Helmholtz, felt that they could side-step the issue by assuming that viable microbes—“cosmozoa”—had been delivered to the primitive Earth by meteorites, thus maintaining the significance of evolution.


In his monograph on the radiolaria, Haeckel wrote “The chief defect of the Darwinian theory is that it throws no light on the origin of the primitive organism—probably a simple cell—from which all the others have descended. When Darwin assumes a special creative act for this first species, he is not consistent, and, I think, not quite sincere …” (Haeckel 1862).

In 1871, Ernst Haeckel published in Nature Magazine an article on the origin of life, describing Biological cells as essentially and nothing more than a bit of structureless, simple " Protoplasm "- and their other vital properties can therefore simply and entirely brought about by the entirely by the peculiar and complex manner in which carbon under certain conditions can combine with the other elements further down, the author writes: Abiogenesis is, in fact, a necessary and integral part of the universal evolution theory.  7





The situation changed with the proposal of an heterotrophic origin of life made in 1924 by A.I.Oparin, a young Russian biochemist. Oparin was convinced that it was impossible to reconcile his Darwinian beliefs in a gradual evolution of complexity with the commonly held suggestion that life had emerged already endowed with an autotrophic metabolism. He reasoned that since heterotrophic anaerobes were metabolically simpler than autotrophs, the former would necessarily have evolved first. Based on the simplicity of fermentative metabolism, Oparin suggested that the first organisms must have been heterotrophic bacteria that could not make their own food but consumed organic material present in the primitive milieu. 

Like many of his fellow students and colleagues, Oparin was well acquainted with Haeckel’s work, in which the transition of the nonliving to the first organisms was discussed but always under the assumption that the first forms of life had been autotrophic microbes. Analysis of Oparin’s writings shows that throughout his entire life he remained faithful to the Haeckelian division of life into plants, animals and protists. However, from the very beginning it was impossible for him to reconcile his biochemical understanding of the sophistication of photosynthesis and the Darwinian credence in a gradual, slow evolution from the simple to the complex, with the suggestion that life had emerged already endowed with an autotrophic metabolism that included enzymes, chlorophyll and the ability to synthesize organic compounds from CO2 and water.

His 1924 book can be read as the work of a young, bold, and talented researcher with abundant enthusiasm and free of intellectual prejudices, who was able to look beyond the boundaries separating different scientific fields. In retrospect, it can be also considered the harbinger of his major work, a 1936 volume in Russian also called Origin of Life, whose English translation became available 2 years later (Oparin 1938).

The new volume was far more mature and profound in its philosophical and evolutionary analysis, as argued forcefully by Graham (1972), reflecting the changes in a society that was attempting to develop science, art and culture within the framework of dialectical materialism. In his second book Oparin (1938) not only abandoned his naïve and crude materialism, but also provided a thorough presentation and extensive analysis of the literature on the abiotic synthesis of organic material. His original proposal was revised, leading to the assumption of a highly reducing primitive mileu in which iron carbides of geological origin would react with steam to form hydrocarbons. Their oxidation would yield alcohols, ketones, aldehydes, etc., that would then react with ammonia to form amines, amides and ammonium salts. The resulting proteinlike compounds and other molecules would form a dilute solution, where they would aggregate to form colloidal systems from which the first heteretrophic microbes evolved (Oparin 1938).



Five years later J. B. S. Haldane independently published a similar hypothesis, which explains why such views are often credited to both scientists. Oparin’s ideas were further elaborated in a more extensive book published in 1936 in Russian and two years later translated into English. In this new book, which is a major classic in evolutionary analysis, Oparin revised his original proposal, leading to the assumption of a highly reducing milieu in which iron carbides of geological origin would react with steam to form hydrocarbons. Their oxidation would yield alcohols, ketones, aldehydes, etc., that would then react with ammonia to form amines, amides, and ammonium salts. The resulting protein-like compounds would form a hot dilute soup, which would aggregate to form colloids or coacervates, from which the first heterotrophic microbes evolved. Oparin did not address in his 1938 book the origin of nucleic acids because at the time their role in genetic processes was not yet suspected.

For Oparin, highly reducing atmospheres corresponded to mixtures of CH4, NH3, and H2O with or without added H2. The atmosphere of Jupiter contains these chemical species, with H2 in large excess over CH4. Oparin’s proposal of a primordial reducing atmosphere was a brilliant inference from the then-fledgling knowledge of solar atomic abundances and planetary atmospheres. The benchmark contributions of Oparin’s 1938 book include the hypothesis that heterotrophs and anaerobic fermentation were primordial, which led him to refine the idea of the proposal of a reducing atmosphere that could allow the prebiotic synthesis and accumulation of organic compounds. These ideas played a major role in shaping the views of Harold Clayton Urey, an avid experimentalist with a wide range of scientific interests that was interested in the composition of the early atmosphere based on then popular ideas of solar system
formation. 

Questions and ideas about the nature of life dominated the field to such an extent that it was only after the 1950s, with new experimental techniques and information from different disciplines, that the question of the origins of life shifted from an area of speculation to an active area of experimental investigations.

Abiogenesis research  from 1950 to 2000




In 1952 Urey published The Planets, their Origin and Development, which delineated his ideas of the formation of the solar system, a formative framework into which most origin of life theories are now firmly fixed, albeit in slightly modified fashion. However, not everybody accepted these ideas. In 1951 Rubey proposed an outgassing model based on an early core differentiation and assumed the early atmosphere would have been reminiscent of modern volcanic gases. In his model Rubey estimated that a CH4 atmosphere could not have persisted for much more than 105 to 108 years due to photolysis. The Urey/Oparin atmospheric (CH4, NH3, H2O) models are thus based on astrophysical and cosmochemical models, while Rubey's CO2, N2, H2O model is based on extrapolation of the geological record. Although this early theoretical work has had a great influence on subsequent research, modern thinking on the origin and evolution of the chemical elements, the solar system, the Earth, and its atmosphere and oceans has not been shaped largely with the origin of life as a driving force. On the contrary, current origin of life theories have been modified to fit contemporary models in geo- and cosmochemistry.

The Miller Urey experiment 3
The evidence of Urey-Miller experiment
1a. Amino Acid Synthesis (1953). When Stanley Miller produced a few amino acids from chemicals, amid a continuous small sparking apparatus, newspaper headlines proclaimed: “Life has been created!” But naturalists hide the truth: The experiment had disproved the possibility that random emergence of the building blocks could occur.
1b. The amino acids were not biologically active, and the experiment only proved that a synthetic production of them would result in equal amounts of left- and right-handed amino acids. Since only left-handed ones exist in animals, accidental production could never produce a living creature.
2. Till nowadays life could not be created in any laboratory. Therefore, by eliminative induction, we can conclude life must have been created by God.
3. God most probably, exists.

Stanley L. Miller, who had arrived to Chicago in the spring of 1951 after graduating from the University of California, Berkeley, attended Urey’s lecture, who like Oparin suggested that it would be interesting to simulate the proposed reducing conditions of the primitive Earth to test the feasibility of organic compound synthesis. “Urey’s point immediately seemed valid to me,” wrote Miller many years afterward. “After this seminar someone pointed out to Urey that in his book Oparin had discussed the origin of life and the possibility of synthesis of organic compounds in a reducing atmosphere. Urey’s discussion of the reducing atmosphere was more thorough and convincing than Oparin’s; but it is still surprising that no one had by then performed an experiment based on Oparin’s ideas” (Miller 1974).

Almost a year and a half after Urey’s lecture, Miller approached Urey about the possibility of doing a prebiotic synthesis experiment using a reducing gas mixture. After overcoming Urey’s initial resistance, he designed three apparatuses meant to simulate the ocean-atmosphere system on the primitive Earth by investigating the action of electric discharges acting for a week on a mixture of CH4, NH3, H2, and H2O; racemic mixtures of several protein amino acids were produced, as well as hydroxy acids, urea, and other organic molecules (Miller 1953, 1955; Johnson et al. 2008).

Miller achieved his results by means of an apparatus in which he could simulate the interaction between an atmosphere and an ocean. To activate the reaction, Miller used an electrical spark, which was considered to be a significant energy source on the early Earth in the form of lightning and coronal discharges. The apparatus was filled with various mixtures of methane, ammonia, and hydrogen as well as water, the latter being heated to boiling during the experiment. A spark discharge between the tungsten electrodes was produced by a high frequency Tesla coil with a voltage of 60,000 V. The reaction time was usually a week or so and the maximum pressure 1.5 bars. With this relatively simple experimental setup, Miller (1953) was able to transform almost 50% of the original carbon (in the form of methane) into organic compounds. Although most of the synthesized organic material was an insoluble tarlike solid, he was able to isolate amino acids and other simple organic compounds from the reaction mixture. Glycine, the simplest amino acid, was produced in 2% yield (based on the original amount of methane carbon), whereas alanine, the simplest amino acid with a chiral center, showed a yield of 1%. Miller was able to show that the alanine was a racemic mixture (equal amounts of d- and l-alanine). This provided convincing evidence that the amino acids were produced in the experiment and were not biological contaminants somehow introduced into the apparatus.

The first major result in the field of biogenesis was a 1953 experiment by Stanley Miller and Harold Urey. In this experiment, the researchers tested an earlier hypothesis that conditions on the early earth may have favored the synthesis of organic compounds from inorganic compounds. They placed water plus some gases in a sealed flask, then passed electric sparks through the mixture to simulate the effects of sunlight and lightning. Over the next week or so, the mixture in the flask slowly turned a reddish-brown color. Upon analyzing the resulting "goo," they discovered that it contained several amino acids, which are the building blocks of proteins. The Miller-Urey experiment firmly established that basic biochemical building blocks such as amino acids can spontaneously form given the right conditions. Nonetheless, researchers have more recently pointed out that in current models of early earth's atmosphere and oceans, carbon dioxide and nitrogen would have reacted to form nitrites, which quickly destroy amino acids. Thus the Miller-Urey experiment might not be truly representative of what really happened on the early earth. Going beyond the synthesis of basic amino acids, one leading hypotheses is that ribonucleic acid (RNA) played a key role. For example, researchers recently found that certain RNA molecules can greatly increase the rate of specific chemical reactions, including, remarkably, the replication of parts of other RNA molecules. Thus perhaps a molecule like RNA could "self-catalyze" itself in this manner, perhaps with the assistance of some related molecules, and then larger conglomerates of such compounds, packaged within simple membranes (such as simple hydrophobic compounds), could have formed very primitive cells. 6

Nonetheless, even the "RNA world" hypothesis, as the above scenario is popularly known, faces challenges. As biochemist Robert Shapiro notes, "Unfortunately, neither chemists nor laboratories were present on the early Earth to produce RNA.". These difficulties have led scientists to hypothesize even simpler building blocks, such as self-catalyzing networks of biomolecular agents. Shapiro sketches five basic required characteristics of such a system: (a) a boundary is needed to separate life from non-life; (b) an energy source is needed to drive the organization process; (c) a coupling mechanism must link the release of energy to the organization process that produces and sustains life; (d) a chemical network must be formed, to permit adaptation and evolution; and (e) the network must grow and reproduce. Such hypothesized systems are now termed "metabolism first" schemes. Much remains to be done to establish the validity of this scenario.

4


An important survey of the origin-of-life (OOL) field has been published in Scientific American.  Robert Shapiro, a senior prize-winning chemist, cancer researcher, emeritus professor and author of books in the field, debunks the Miller experiment, the RNA World and other popular experiments as unrealistic dead ends.  Describing the wishful thinking of some researchers, he said, “In a form of molecular vitalism, some scientists have presumed that nature has an innate tendency to produce life’s building blocks preferentially, rather than the hordes of other molecules that can also be derived from the rules of organic chemistry.”

Shapiro had been explaining that millions of organic molecules can form that are not RNA nucleotides.  These are not only useless to life, they get in the way and clog up the beneficial reactions.  He went on to describe how extrapolation from the Miller Experiment produced an unearned sense of euphoria among researchers: “By extrapolation of these results, some writers have presumed that all of life’s building could be formed with ease in Miller-type experiments and were present in meteorites and other extraterrestrial bodies.  This is not the case,” he warned in a section entitled, “The Soup Kettle Is Empty.”  He said that no experiment has produced amino acids with more than three carbons (life uses some with six), and no Miller-type experiment has ever produced nucleotides or nucleosides, essential for DNA and RNA.

Shapiro described in some detail the difficult steps that organic chemists employ to synthesize the building blocks of RNA, using conditions highly unrealistic on the primitive earth.  “The point was the demonstration that humans could produce, however inefficiently, substances found in nature,” he said.  “Unfortunately, neither chemists nor laboratories were present on the early Earth to produce RNA.”  Here, for instance, is how scientists had to work to create cytosine, one of the DNA bases:

I will cite one example of prebiotic synthesis, published in 1995 by Nature and featured in the New York Times.  The RNA base cytosine was prepared in high yield by heating two purified chemicals in a sealed glass tube at 100 degrees Celsius for about a day.  One of the reagents, a sealed glass tube at 100 degrees Celsius for about a day.  One of the reagents, cyanoacetaldehyde, is a reactive substance capable of combining with a number of common chemicals that may have been present on the early Earth.  These competitors were excluded.  An extremely high concentration was needed to coax the other participant, urea, to react at a sufficient rate for the reaction to succeed.  The product, cytosine, can self-destruct by simple reaction with water.  When the urea concentration was lowered, or the reaction allowed to continue too long, any cytosine that was produced was subsequently destroyed.  This destructive reactionhad been discovered in my laboratory, as part of my continuing research on environmental damage to DNA.  Our own cells deal with it by maintaining a suite of enzymes that specialize in DNA repair.

There seems to be a stark difference between the Real World and the imaginary RNA World.  Despite this disconnect, Shapiro describes some of the hype the RNA World scenario generated when Gilbert first suggested it in 1986.  “The hypothesis that life began with RNA was presented as a likely reality, rather than a speculation, in journals, textbooks, and the media,” he said.  He also described the intellectual hoops researchers have envisioned to get the scenario to work: freezing oceans, drying lagoons, dry deserts and other unlikely environments in specific sequences to keep the molecules from destroying themselves.  This amounts to attributing wish-fulfillment and goal-directed behavior to inanimate objects, as Shapiro makes clear with this colorful analogy:

The analogy that comes to mind is that of a golfer, who has played a golf ball through an 18-hole course, then assumed that the ball could also play itself around the course in his absence.  He had demonstrated the possibility of the event; it was only necessary to presume that some combination of natural forces (earthquakes, winds, tornadoes, and floods, for example) could produce the same result, given enough time.  No physical law need be broken for spontaneous RNA formation to happen, but the chances against it are so immense, that the suggestion implies that the non-living world had an innate desire to generate RNA.  Themajority of origin-of-life scientists who still support the RNA-first theory either accept this concept (implicitly, if not explicitly) or feel that the immensely unfavorable odds were simply overcome by good luck.

Realistically, unfavorable molecules are just as likely to form.  These would act like terminators for any hopeful molecules, he says.  Shapiro uses another analogy.  He pictures a gorilla pounding on a huge keyboard containing not only the English alphabet but every letter of every language and all the symbol sets in a typical computer.  “The chances for the spontaneous assembly of a replicator in the pool I described above can be compared to those of the gorilla composing, in English, a coherent recipe for the preparation of chili con carne.”  That’s why Gerald Joyce, Mr. RNA-World himself, and Leslie Orgel, a veteran OOL researcher with Stanley Miller, concluded that the spontaneous appearance of chains of RNA on the early earth “would have been a near miracle.

Boy and all this bad news is only halfway through the article.  Does he have any good news?  Not yet; we must first agree with a ground-rule stated by Nobel laureate Christian de Duve, who called for “a rejection of improbabilities so incommensurably high that they can only be called miracles, phenomena that fall outside the scope of scientific inquiry.”  That rules out starting with complex molecules like DNA, RNA, and proteins.

From that principle, Shapiro advocated a return to scenarios with environmental cycles involving simple molecules.  These thermodynamic or “metabolism first” scenarios are only popular among about a third of OOL researchers at this time.  Notable subscribers include Harold Morowitz, Gunter Wachtershauser, Christian de Duve, Freeman Dyson and Shapiro himself.  Their hypotheses, too, have certain requirements that must be met: an energy source, boundaries, ways to couple the energy to the organization, and a chemical network or cycle able to grow and reproduce.  (The problems of genetics and heredity are shuffled into the future in these theories.)  How are they doing?  “Over the years, many theoretical papers have advanced particular metabolism first schemes, but relatively little experimental work has been presented in support of them,” Shapiro admits.  “In those cases where experiments have been published, they have usually served to demonstrate the plausibility of individual steps in a proposed cycle.”  In addition, “An understanding of the initial steps leading to life would not reveal the specific events that led to the familiar DNA-RNA-protein-based organisms of today.”  Nor would plausible prebiotic cycles prove that’s what happened on the early earth.  Success in the metabolism-first experiments would only contribute to hope that prebiotic cycles are plausible in principle, not that they actually happened. Nevertheless, Shapiro himself needed to return to the miracles he earlier rejected.  “Some chance event or circumstance may have led to the connection of nucleotides to form RNA,” he speculates.  Where did the nucleotides come from?  Didn’t he say their formation was impossibly unlikely?  How did they escape rapid destruction by water?  Those concerns aside, maybe nucleotides initially served some other purpose and got co-opted, by chance, in the developing network of life.  Showing that such thoughts represent little more than a pipe dream, though, he admits: “Many further steps in evolution would be needed to ‘invent’ the elaborate mechanisms for replication and specific protein synthesis that we observe in life today.”





Time for Shapiro’s grand finale.  For an article predominantly discouraging and critical, his final paragraph is surprisingly upbeat.  Recounting that the highly-implausible big-molecule scenarios imply a lonely universe, he offers hope with the small-molecule alternative.  Quoting Stuart Kauffman, “If this is all true, life is vastly more probable than we have supposed.  Not only are we at home in the universe, but we are far more likely to share it with unknown companions.” Letters to the editor appeared in Science the next day, debating the two leading theories of OOL.  The signers included most of the big names: Stanley Miller, Jeffrey Bada, Robert Hazen and others debating Gunter Wachtershauser and Claudia Huber.  After sifting through the technical jargon, the reader is left with the strong impression that both camps have essentially falsified each other.  On the primordial soup side, the signers picked apart details in a paper by the metabolism-first side.  Concentrations of reagants and conditions specified were called “implausible” and “exceedingly improbable.”

Wachtershauser and Huber countered that the “prebiotic soup theory” requires a “protracted, mechanistically obscure self-organization in a cold, primitive ocean,” which they claim is more improbable than the volcanic environment of their own “pioneer organism” theory (metabolism-first).  It’s foolish to expect prebiotic soup products to survive in the ocean, of all places, “wherein after some thousand or million years, and under all manner of diverse influences, the magic of self-organization is believed to have somehow generated an unspecified first form of life.”  That’s some nasty jabbing between the two leading camps.

The Miller Experiment, the RNA World, and all the hype of countless papers, articles, popular press pieces and TV animations are impossible myths. You know you cannot stay with small molecules forever.  You have not begun to bridge the canyon between metabolic cycles with small molecules to implausible genetic networks with large molecules (RNA, DNA and proteins).  Any way you try to close the gap, you are going to run into the very same criticisms you raised against the RNA-World storytellers.  You cannot invoke natural selection without accurate replication.

Funny how these people presume that if they can just get molecules to pull themselves up by their bootstraps to the replicator stage, Charlie and Tinker Bell will take over from there.  Before you can say 4 Gya, biochemists emerge! Shapiro is very valuable for exposing the vast difference between the hype over origin of life and its implausibilities – nay, impossibilities – in the chemistry of the real world.  His alternative is weak and fraught with the very same difficulties.  If a golf ball is not going to finish holes 14-18 on its own without help, it is also not going to finish holes 1-5.  If a gorilla is not going to type a recipe in English for chili con carne from thousands of keys on a keyboard, it is not going to type a recipe for hot soup either, even using only 1% of the keys.  Furthermore, neither the gorilla nor the golf ball are going to want to proceed further with the evolutionist project.  We cannot attribute an “innate desire” to a gorilla, a golf ball, or a sterile planet of chemicals to produce coded languages and molecular machines. Sooner or later, all the machinery, the replicators, the genetic codes and complex entropy-lowering processes are going to have to show up in the accounting.  Once Shapiro realizes that his alternative is just as guilty as the ones he criticizes, we may have an ardent new advocate of intelligent design in the ranks.  Join the winning side, Dr. Shapiro, before sliding with the losers and liars into the dustbin of intellectual history. 

Formation of nucleobases in a Miller–Urey reducing atmosphere  5
The Miller–Urey experiments pioneered modern research on the molecular origins of life, but their actual relevance in this field was later questioned because the gas mixture used in their research is considered too reducing with respect to the most accepted hypotheses for the conditions on primordial Earth. In particular, the production of only amino acids has been taken as evidence of the limited relevance of the results. Here, we report an experimental work, combined with state-of-the-art computational methods, in which both electric discharge and laser-driven plasma impact simulations were carried out in a reducing atmosphere containing NH3 + CO. We show that RNA nucleobases are synthesized in these experiments, strongly supporting the possibility of the emergence of biologically relevant molecules in a reducing atmosphere. The reconstructed synthetic pathways indicate that small radicals and formamide play a crucial role, in agreement with a number of recent experimental and theoretical results.

Note that they have transformed the phrase "laser-driven plasma impact simulations" into "we show that RNA nucleobases are synthesized in these experiments ..." look at that - Virtual simulations through a computer program and databases.   Can they tell us the if the amino acids got homochiral and biologically active?

1. http://www.nytimes.com/books/first/d/davies-miracle.html
2. From the paper: The Origin of Biomolecules, page 3
3. http://creationsafaris.com/crev200702.htm#20070215a
4. LIFE The Science of Biology TENTH EDITION, page 70
5. http://www.pnas.org/content/early/2017/04/04/1700010114.abstract
6. http://www.sciencemeetsreligion.org/evolution/origin.php
7. https://www.nature.com/articles/003354b0.pdf
8. In Search of Cell History , The Evolution of Life’s Building Blocks,  page 86
9. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2964185/
10. Origins of Life: The Primal Self-Organization,    page 87
11. https://en.wikipedia.org/wiki/Life
12. http://www.washington.edu/news/2013/12/12/scientists-discover-double-meaning-in-genetic-code/



Last edited by Admin on Mon Dec 04, 2017 1:04 am; edited 32 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Crack the Genetic Code and Cipher
British biologist Francis Crick and his American colleague James Watson laid the groundwork for modern molecular genetics when they determined the structure of DNA in 1953. While demonstrating how the strands of the double helix were put together, Watson and Crick also sought to learn how genetic information was coded into the DNA. Crick’s “central dogma” of molecular biology—“DNA makes RNA makes protein”—signified the importance of the processes of transcription (the creation of messenger RNA) and translation (the production of proteins). Once this became the canonical basis of the genetic transfer of information, the next item on the scientific agenda was the genetic code itself—the instructions that regulated the dogma’s implementation, the true “secret of life”.
The first scientist after Watson and Crick to find a measure of success with the coding problem was Russian émigré physicist George Gamow. He envisioned the relationship between DNA structure and protein synthesis as a numerical cryptanalytic problem. Gamow surmised that the goal for scientists was to learn how a long sequence of 4 nucleotides determines the assignment of long protein sequences composed of 20 amino acids. Gamow published a short piece in the October 1953 issue of Nature that proposed a solution called the “diamond code”, an overlapping triplet code based on a combinatorial scheme in which 4 nucleotides arranged 3-at-a-time would specify 20 amino acids. Somewhat like a language, this highly restrictive code was primarily hypothetical, based on then-current knowledge of the behavior of nucleic acids and proteins. 4

Gamow’s coding scheme generated a great deal of enthusiasm among other scientists. To foster communication and camaraderie, Gamow founded the RNA Tie Club, a group of 20 hand-picked scientists—corresponding to the 20 amino acids—who would circulate notes and manuscripts on the coding problem and (not inconsequentially) consume wine, beer, and whiskey at periodic meetings. Each member of the club was given the moniker of an amino acid, and all were presented with a diagrammed tie and tiepin made to Gamow’s specification. Although geographically dispersed, the Tie Club brought physical scientists and biologists together to work on one of the most challenging and important problems in modern science.

By mid-1954, Gamow had accepted that his diamond code was not accurate, yet he and others continued to deliberate over the various codes presented by disparate researchers. In truth, the notion of a “code” as the key to information transfer was not articulated publicly until late 1954, when Gamow, Martynas Ycas, and Alexander Rich published an article that defined the code idiom for the first time since Watson and Crick casually mentioned it in a 1953 article. Yet the concept of coding applied to genetic specificity was somewhat misleading, as translation between the 4 nucleic acid bases and the 20 amino acids would obey the rules of a cipher instead of a code. As Crick acknowledged years later, in linguistic analysis, ciphers generally operate on units of regular length (as in the triplet DNA scheme), whereas codes operate on units of variable length (e.g., words, phrases). But the code metaphor worked well, even though it was literally inaccurate, and in Crick’s words, “‘Genetic code’ sounds a lot more intriguing than ‘genetic cipher’.” Codes and the information transfer metaphor were extraordinarily powerful, and heredity was often described as a biological form of electronic communication.

By 1955, research suggested that a nonoverlapping code was more plausible than Gamow’s original notion of overlapping triplets. By 1961, Crick and his colleagues (including Sydney Brenner) concluded that the nucleotides of each triplet did not belong to any other triplet. They also postulated that sets of triplets are arranged in continuous linear sequence starting at a fixed point in a polynucleotide chain without breaks, an aspect of the code that was termed “commaless”. The notion of a “degenerate code” was also introduced, which meant that more than one triplet can code for a particular amino acid (a possibility inherent in the fact that there were 64 possible triplets out of 4 base pairs and only 20 amino acids to be coded for). These discoveries in the decade before 1961 brought scientists closer to a clear vision of what the genetic code might look like, but it was experimental biochemical investigation in the 1960s that finally led biologists to the solution of the code.
In 1957, a 30-year-old biochemist named Marshall Nirenberg began work at the National Institutes of Health (NIH) in Bethesda, MD. Nirenberg was one among a veritable litter of young talent at the NIH, where biochemistry occupied a privileged place. The young scientist was fascinated with the role of genetic control and notions of “information flow” in biochemical reactions and cellular functions. Yet in a scientific culture that encouraged team science, Nirenberg tended to work alone. Years later, in a New York Times profile, he was described as a “genius because he does one thing superlatively well, but he has trouble driving cars, and he has been known to trip over his feet . . . works 12 hours a day 7 days a week and has no outside hobbies.” Although Nirenberg contested this description, he did recognize that working alone stymied his attempts to engage the major problems of contemporary biology. Still, although he was aware of the competition among leading laboratories to solve problems like protein synthesis, he worked in relative isolation for a few years, studying the cell-free synthesis of the enzyme penicillinase in the Bacillus cereus bacteria.

In 1960, Gordon Tomkins offered Nirenberg a position as a research biochemist in NIH’s Section of Metabolic Enzymes. There, he ceased study of the B. cereus system and focused his research on a cell-free E. coli system. By the summer of 1960, Nirenberg concluded that cell-free protein synthesis was dependent on the DNA template that specified the RNA messenger. Other researchers, including Nobel laureate Severo Ochoa, had arrived at similar conclusions and were determined to solve protein synthesis and crack the genetic code, but Nirenberg had never been as focused as he was at that moment. Auspiciously, he was joined at NIH in the autumn of that year by German plant physiologist Heinrich Matthaei, a postdoctoral fellow who planned to work with Nirenberg on protein synthesizing systems. Matthaei’s arrival signaled, in Nirenberg’s words, a “new phase” in the research.

By December 1960, Nirenberg and Matthaei worked intently on the E. coli system, attempting to incorporate amino acids in the DNAase-supplemented system and to establish definitively that the system was dependent on an RNA template. The two scientists demonstrated that endogenous messenger RNA did stimulate protein synthesis, but they needed a better, less-contaminated RNA preparation. They ultimately decided that the RNA of the tobacco mosaic virus (TMV) would be a viable template. This conclusion converged with the efforts of Heinz Frankel-Conrat at the Berkeley Virus Laboratory, which was leading the race to decipher the code. In the spring of 1961, Nirenberg traveled to Berkeley, visiting Frankel-Conrat’s laboratory to gain facility with TMV. Meanwhile, Matthaei began the experiments on May 15, testing poly-A (polyadenylic acid), poly-U (poly-uridylic acid), poly-(2A)U, and poly-(4A)U for amino acid incorporation. Each synthetic polynucleotide was tested in the presence of 19 unlabeled (cold) and 1 labeled (hot) amino acids. On the morning of May 27, the results of experiment 27Q indicated that poly-U specified the assembly of hot polyphenyalanine. It was the first break in the genetic code.

Matthaei phoned the poly-U results to Nirenberg at Berkeley, but Nirenberg did not release the results publicly. Neither man was a member of biochemistry’s “inner circle”, and thus, Nirenberg wanted to continue experimenting before announcing the momentous discovery. Returning to NIH, he and Matthaei continued their polynucleotide work. It was not until October that they released the information in two papers, although Nirenberg presented his findings at the International Congress of Biochemistry in August. The announcement was a major defeat for Crick and other major players in the field, who had been trying to break the code for years. Some begrudged the obscure young scientists their success, and others claimed that it was a lucky strike. Gamow, in particular, resented not being cited for his work in their 1961 paper. (Nirenberg claimed to have never heard of it.) Nevertheless, Nirenberg and Matthaei accomplished one of the premier feats in the history of science, doing what Nobel laureates and other leading figures had been unable to do.

Biochemical research after this grand achievement was directed primarily toward the completion of the code and took approximately six years. In 1964, Nirenberg and Philip Leder discovered a technique for making coding assignments using trinucleotides, and in the following year, Har Gobind Khorana perfected a precise technique for synthesizing long RNA chains of completely defined sequences. After these achievements, the entire code was elucidated within a year. All 20 amino acids were accounted for, and Crick devised a standard form in which to present the genetic code, a table that has the same importance for biology that the periodic table has for chemistry.

Watson and Crick had won their Nobel Prize in 1962 for discovering the structure of DNA. Nirenberg (along with Gobind Khorana and Robert Holley) matched them in 1968, when he was also awarded the Nobel Prize in Physiology or Medicine. Thus, an incredible achievement for an “outsider” was acknowledged at the end of two decades of amazing research in the nascent field of molecular biology. The discovery of the genetic code, or more accurately the “genetic cipher”, would inaugurate an era of astonishing genetic research that continues today.

During the 1950s and 1960s, the functioning of an organism was increasingly modeled on the computer, and computers were applied not only to genetics but also to other branches of the life sciences, such as X-ray crystallography, physiology, neurology and evolutionary biology. What was novel in DNA sequencing was not the conceptualization of genetic information, but the way in which biologists – especially molecular biologists – began using this concept and applying computational technologies to it. In 1953, after the elucidation of the double helix, James Watson and Francis Crick published a sequel paper in which they considered it ‘likely that the precise sequence of bases [in DNA] is the code which carries the genetical information’. In 1957, Crick postulated the central dogma of molecular biology, according to which the nucleotide sequence of DNA determined the amino acid sequence of proteins through a one-directional transfer of information. Despite both papers defining DNA as a sequence, the further research agenda that Watson and Crick promoted for molecular biology was largely inspired by the notions of code and one-directional transfer of information. These notions constituted a conceptual framework which, during the late 1950s and 1960s, shaped investigations into the processes of cell division, gene regulation and protein synthesis. DNA was not considered information because of its sequential nature, but because its genetic code could determine other entities – direct the synthesis of proteins or its own replication in an identical DNA molecule. In this context, the transfer of genetic information mimicked the functioning of the most widely known computers of the time, central mainframe apparatuses which, having conducted a series of logical operations, were able to transform input data introduced by the user into a defined output. 5

The RNA World hypothesis
A possible solution to the problem posed by the lack of understanding of the relationship between nucleic acids and proteins was suggested by Carl Woese (1967), Leslie Orgel (1968), and Francis Crick (1968), who independently proposed the idea that the first living entities were based on RNA as both the genetic material and as catalyst. Surprisingly, these pioneering proposals of an RNA world received little attention. The relationship between evolutionary issues and molecular biology was slow to develop, and during several decades was embittered by frequent clashes during which evolutionary analysis was frequently dismissed as little more than useless speculation.


How the discovery of ribozymes cast RNA in the roles of both chicken and egg in origin-of-life theories 3

A 1971 paper by the Nobel-winning physical chemist Manfred Eigen begins with the following snapshot of the status of origins of-life research at the time:

The question about the origin of life often appears as a question about ‘‘cause and effect’’ [...] As a consequence of the exciting discoveries of ‘‘molecular biology’’ a common version of the above question is: Which came first, the protein or the nucleic acid?—a modern variant of the old ‘‘chicken-and-the-egg’’ problem. The term ‘‘first’’ is usually meant to define a causal rather than a temporal relationship, and the words ‘‘protein’’ and ‘‘nucleic acid’’ may be substituted by ‘‘function’’ and ‘‘information’’. The question in this form, when applied to the interplay of nucleic acids and proteins as presently encountered in the living cell, leads ad absurdum, because ‘‘function’’ cannot occur in an organized manner unless ‘‘information’’ is present and this ‘‘information’’ only acquires its meaning via the ‘‘function’’ for which it is coding.

On one side were those that emphasized the importance of the cell’s nucleus to life, and hence the functions of information and replication. On the opposite camp were those who gave primacy to the cytoplasm, and consequently, catalytic and metabolic activities.  This dichotomy made its first formal appearance in the scientific community at a session on the origins of life at the 1912 British Association for the Advancement of Science meeting at Dundee where E.A. Minchin, a zoologist from Oxford University, opened the discussion with an argument favoring the nucleocentric view:

By most biologists the cytoplasm has been considered to represent the true living substance. [.. .] There are, however, many reasons for believing that the chromatin-substance, invariably present in the nucleus, or occurring as grains, chromidia, scattered in the cytoplasm, represents the primary and essential living matter. [.. .] I regard the chromatin as the primitive living substance, and hold the view that the earliest forms of life were very minute particles of chromatin, round which in the course of evolution achromatinic substances were formed. Within the, cytoplasmic envelopes thus produced the chromatin-grains increased in number. Organisms of the degree of structural
complexity of a true cell arose finally by concentration of the chromatin-grains (chromidiae) into a compact organized mass, the nucleus proper (Minchin, 1912, pp.510–511).

Although his argument is articulated in terms of cellular components—chromatin (and hence nucleus) and cytoplasm—Minchin was clearly according to primacy to chromatin because of its perceived functions since virtually nothing was known about the material of chromatin at the time. His main reasons for adhering to a nucleocentric view of life included first, the observation that chromatin was an essential component of all known living beings, none of which had been known to survive without it, and second, the relationship between the material of chromatin and life-processes such as fertilization and heredity (Minchin, 1912, p. 510). Minchin‘s views were challenged by H. E. Armstrong, then president of the chemistry section (B) of the Royal Society, during the discussion session immediately following the address:

I can not think of a naked mass of protoplasm, call it chromatin (stainable substance) or what you will, playing the part of an organism; At most I imagine it would function as yeast zymase functions. If it is to grow and be reproduced, the nuclear material must be shut up along with the appropriate food materials and such constructive appliances as are required to bring about the association of the various elements entering into the structure of the organism. (Armstrong, 1913, pp. 539–540).

The impasse would remained firmly in place, until the unexpected discovery of the RNA catalysis.


Scientists discover double meaning in genetic code 
In 2013, Scientists  discovered a second code hiding within DNA. This second code contains information that changes how scientists read the instructions contained in DNA and interpret mutations to make sense of health and disease. 

“For over 40 years we have assumed that DNA changes affecting the genetic code solely impact how proteins are made,” said Stamatoyannopoulos. “Now we know that this basic assumption about reading the human genome missed half of the picture. These new findings highlight that DNA is an incredibly powerful information storage device, which nature has fully exploited in unexpected ways.” 2

The genetic code uses a 64-letter alphabet called codons. The UW team discovered that some codons, which they called duons, can have two meanings, one related to protein sequence, and one related to gene control. 


Clearly, making two sequences that satisfy two sets of functional constraints simultaneously is more difficult than constructing a single sequence that must satisfy only one set of such constraints. Thus, the probability of generating such a meaningful message within another meaningful message is vastly smaller than the odds of getting a single message to arise by chance on its own. For this reason, the discovery of dual and overlapping messages in genetic texts—messages essential to function—only complicates the information problem for scenarios that rely on chance and/or natural selection. Indeed, a trial-and-error process seems unlikely to produce nested coding of information, since the probability of error increases with each trial when two or more sets of functional constraints have to be satisfied. And many functional outcomes in the cell depend upon satisfying multiple sets of constraints. 

Further, since self-organizational affinities fail to explain the sequential arrangements of DNA base sequences generally, they do nothing to account for even more sophisticated forms of sequencing (i.e., those involving dual messaging) in the genome. Instead, this form of encryption seems to point decisively to design, because the use of such encryption techniques are, based upon our experience, the sole province of intelligent agents. We know of no other such cause of this effect. The evidence of sophisticated encryption techniques within the genome thus constitutes another distinctive diagnostic—or signature—of intelligence in the cell.

From Primordial Soup to the Prebiotic Beach
An interview with exobiology pioneer, Dr. Stanley L. Miller, University of California San Diego

1n 1953, a University of Chicago graduate student named Stanley Miller working in Harold Urey's lab flipped a switch sending electric current through a chamber containing a combination of methane, ammonia, hydrogen and water. The experiment yielded organic compounds including amino acids, the building blocks of life, and catapulted a field of study known as exobiology into the headlines. Since that time a new understanding of the workings of RNA and DNA, have increased the scope of the subject. Moreover, the discovery of prebiotic conditions on other planets and the announcement of a bacterial fossil originating on Mars has brought new attention to the study of life's origins. I spoke with Dr. Miller in his lab at UCSD about the field he has helped to make famous, exobiology.

Let start with the basics. Can you give a simple definition of exobiology?
The term exobiology was coined by Nobel Prize-winning scientist Joshua Lederberg. What it means is the study of life beyond the Earth. But since there's no known life beyond the Earth people say its a subject with no subject matter. It refers to the search for life elsewhere, Mars, the satellites of Jupiter and in other solar systems. It is also used to describe studies of the origin of life on Earth, that is, the study of pre-biotic Earth and what chemical reactions might have taken place as the setting for life's origin.

Some 4.6 billion years ago the planet was a lifeless rock, a billion years later it was teeming with early forms of life. Where is the dividing line between pre-biotic and biotic Earth and how is this determined?

We start with several factors. One, the Earth is fairly reliably dated to 4.55 billion years. The earliest evidence for life was 3.5 billion years based on findings at the Apex formation in Western Australia. A new discovery reported in the journal Nature indicates evidence for life some 300 million years before that. We presume there was life earlier, but there is no evidence beyond that point.
We really don't know what the Earth was like three or four billion years ago. So there are all sorts of theories and speculations. The major uncertainty concerns what the atmosphere was like. This is major area of dispute. In early 1950's, Harold Urey suggested that the Earth had a reducing atmosphere, since all of the outer planets in our solar system- Jupiter, Saturn, Uranus and Neptune- have this kind of atmosphere. A reducing atmosphere contains methane, ammonia, hydrogen and water. The Earth is clearly special in this respect, in that it contains an oxygen atmosphere which is clearly of biological origin.
Although there is a dispute over the composition of the primitive atmosphere, we've shown that either you have a reducing atmosphere or you are not going to have the organic compounds required for life. If you don't make them on Earth, you have to bring them in on comets, meteorites or dust. Certainly some material did come from these sources. In my opinion the amount from these sources would have been too small to effectively contribute to the origin of life.

So while these are potential sources of organic compounds they are not essential for the creation of life on Earth?

As long as you have those basic chemicals and a reducing atmosphere, you have everything you need. People often say maybe some of the special compounds came in from space, but they never say which ones. If you can make these chemicals in the conditions of cosmic dust or a meteorite, I presume you could also make them on the Earth. I think the idea that you need some special unnamed compound from space is hard to support.
You have to consider separately the contributions of meteors, dust and comets. The amount of useful compounds you are going to get from meteorites is very small. The dust and comets may provide a little more. Comets contain a lot of hydrogen cyanide, a compound central to prebiotic synthesis of amino acids as well as purines. Some HCN came into the atmosphere from comets. Whether it survived impact, and how much, are open to discussion. I'm skeptical that you are going to get more than a few percent of organic compounds from comets and dust. It ultimately doesn't make much difference where it comes from. I happen to think prebiotic synthesis happened on the Earth, but I admit I could be wrong.
There is another part of the story. In 1969 a carbonaceous meteorite fell in Murchison Australia. It turned out the meteorite had high concentrations of amino acids, about 100 ppm, and they were the same kind of amino acids you get in prebiotic experiments like mine. This discovery made it plausible that similar processes could have happened on primitive Earth, on an asteroid, or for that matter, anywhere else the proper conditions exist.


Doesn't the Panspermia theory looks at the question of ultimate origins of life in a slightly different way?
That's a different controversy. There are different versions of the theory. One idea is that there was no origin of life, that life, like the universe, has always existed and got to the Earth through space. That idea doesn't seem very reasonable since we know that the universe has not always existed, so life has to happen some time after the big bang 10 or 20 billion years ago.
It may be that life came to Earth from another planet. That may or may not be true, but still doesn't answer the question of where life started. You only transfer the problem to the other solar system. Proponents say conditions may have been more favorable on the other planet, but if so, they should tell us what those conditions were.
Along these lines, there is a consensus that life would have had a hard time making it here from another solar system, because of the destructive effects of cosmic rays over long periods of time.

What about submarine vents as a source of prebiotic compounds?

I have a very simple response to that . Submarine vents don't make organic compounds, they decompose them. Indeed, these vents are one of the limiting factors on what organic compounds you are going to have in the primitive oceans. At the present time, the entire ocean goes through those vents in 10 million years. So all of the organic compounds get zapped every ten million years. That places a constraint on how much organic material you can get. Furthermore, it gives you a time scale for the origin of life. If all the polymers and other goodies that you make get destroyed, it means life has to start early and rapidly. If you look at the process in detail, it seems that long periods of time are detrimental, rather than helpful.

Can you review with us some of the history and basic background of your original prebiotic experiments?

In the 1820's a German chemist named Woeller announced the synthesis of urea from ammonium cyanate, creating a compound that occurs in biology. That experiment is so famous because it is considered the first example where inorganic compounds reacted to make a biological compound. They used to make a distinction between organic, meaning of biological origin, and inorganic- CO2, CO and graphite. We now know that there is no such distinction.
However, it remained a mystery how you could make organic compounds under geological conditions and have them organized into a living organism. There were all sorts of theories and speculation. It was once thought that if you took organic material, rags, rotting meat, etc, and let it sit, that maggots, rats etc. would arise spontaneously. It's not as crazy as it seems, considering DNA hadn't been discovered. It was then reasonable to hold those views if you consider living organisms as protoplasm, a life substance. This all changed in 1860 when Pasteur showed that you don't get living organisms except from other living organisms. This disproved the idea of spontaneous generation.
But spontaneous generation means two things. One is the idea that life can emerge from a pile of rags. The other is that life was generated once, hundreds of millions of years ago. Pasteur never proved it didn't happen once, he only showed that it doesn't happen all the time.
A number of people tried prebiotic experiments. But they used CO2F, nitrogen and water. When you use those chemicals, nothing happens. It's only when you use a reducing atmosphere that things start to happen.

Who came up with the idea of the reducing atmosphere?

Oparin, a Russian scientist, began the modern idea of the origin of life when he published a pamphlet in 1924. His idea was called the heterotrophic hypothesis: that the first organisms were heterotrophic, meaning they got their organic material from the environment, rather than having to make it, like blue-green algae. This was an important idea. Oparin also suggested that the less biosynthesis there is, the easier it is to form a living organism. Then he proposed the idea of the reducing atmosphere where you might make organic compounds.
He also proposed that the first organisms were coacervates, a special type of colloid. Nobody takes that last part very seriously anymore, but in 1936, this was reasonable since DNA was not known to be the genetic material..
In 1951, unaware of Oparin's work, Harold Urey came to the same conclusion about the reducing atmosphere. He knew enough chemistry and biology to figure that you might get the building blocks of life under these conditions.

Tell us about the famous electrical discharge experiment.
The experiments were done in Urey's lab when I was a graduate student. Urey gave a lecture in October of 1951 when I first arrived in Chicago and suggested that someone do these experiments. So I went to him and said, "I'd like to do those experiments". The first thing he tried to do was talk me out of it. Then he realized I was determined. He said the problem was that it was really a very risky experiment and probably wouldn't work, and he was responsible that I get a degree in three years or so. So we agreed to give it six months or a year. If it worked out fine, if not, on to something else. As it turned out I got some results in a matter of weeks. 

In the early 1950s Stanley L. Miller, working in the laboratory of Harold C. Urey at the University of Chicago, did the first experiment designed to clarify the chemical reactions that occurred on the primitive earth. In the flask at the bottom, he created an "ocean" of water, which he heated, forcing water vapor to circulate through the apparatus. The flask at the top contained an "atmosphere" consisting of methane (CH4), ammonia (NH3), hydrogen (H2) and the circulating water vapor.[/center]
Next he exposed the gases to a continuous electrical discharge ("lightning"), causing the gases to interact. Water-soluble products of those reactions then passed through a condenser and dissolved in the mock ocean. The experiment yielded many amino acids and enabled Miller to explain how they had formed. For instance, glycine appeared after reactions in the atmosphere produced simple compounds - formaldehyde and hydrogen cyanide. Years after this experiment, a meteorite that struck near Murchison, Australia, was shown to contain a number of the same amino acids that Miller identified and in roughly the same relative amounts. Such coincidences lent credence to the idea that Miller's protocol approximated the chemistry of the prebiotic earth. More recent findings have cast some doubt on that conclusion.

You must have been excited to get such dramatic results so quickly, and with what, at the time, must have seemed like an outlandish hypothesis?
Oh yes. Most people thought I was a least a little bit crazy. But if you look at methane/ammonia vs CO2/nitrogen there was no doubt in my mind. It was very clear that if you want to make organic compounds it would be easier with methane. It's easy to say that but it is quite a bit more difficult to get organized and do the experiment.
The surprise of the experiment was the very large yield of amino acids. We would have been happy if we got traces of amino acids, but we got around 4 percent. Incidentally, this is probably the biggest yield of any similar prebiotic experiment conducted since then. The reason for that has to do with the fact that amino acids are made from even simpler organic compounds such as hydrogen cyanide and aldehydes.
That was the start. It all held together and the chemistry turned out to be not that outlandish after all.

What was the original reaction to your work in the science community?

There was certainly surprise. One of the reviewers simply didn't believe it and delayed the review process of the paper prior to publication. He later apologized to me. It was sufficiently unusual, that even with Urey's backing it was difficult to get it published. If I'd submitted it to "Science" on my own, it would still be on the bottom of the pile. But the work is so easy to reproduce that it wasn't long before the experiment was validated.
Another scientist was sure that there was some bacterial contamination of the discharge apparatus. When you see the organic compounds dripping off the electrodes, there is really little room for doubt. But we filled the tank with gas, sealed it, put it in an autoclave for 18 hours at 15 psi. Usually you would use 15 minutes. Of course the results were the same.
Nobody questioned the chemistry of the original experiment, although many have questioned what the conditions were on pre-biotic Earth. The chemistry was very solid.

How much of a role did serendipity play in the original setup?

Fortunately, Urey was so adamant at the time about methane that I didn't explore alternate gas mixtures. Now we know that any old reducing gases will do. CO2/hydrogen and nitrogen will do the trick, although not as well.
There was some serendipity in how we handled the water. If we hadn't boiled it and run it for a week, we wouldn't have gotten such good yields of amino acids. We knew right away that something happened rather quickly because you could see a color change after a couple of days.
The fact that the experiment is so simple that a high school student can almost reproduce it is not a negative at all. That fact that it works and is so simple is what is so great about it. If you have to use very special conditions with a very complicated apparatus there is a question of whether it can be a geological process.

The original study raised many questions. What about the even balance of L and D (left and right oriented) amino acids seen in your experiment, unlike the preponderance of L seen in nature? How have you dealt with that question?

All of these pre-biotic experiments yield a racemic mixture, that is, equal amounts of D and L forms of the compounds. Indeed, if you're results are not racemic, you immediately suspect contamination. The question is how did one form get selected. In my opinion, the selection comes close to or slightly after the origin of life. There is no way in my opinion that you are going to sort out the D and L amino acids in separate pools. My opinion or working hypothesis is that the first replicated molecule had effectively no asymmetric carbon

You are talking about some kind of pre-RNA?

Exactly a kind of pre-RNA. RNA has four asymmetric carbons in it. This pre-RNA must have somehow developed into RNA. There is a considerable amount of research now to try and figure out what that pre-RNA compound was, that is, what was the precursor to the RNA ribose-phosphate.

Peter E. Nielsen of the University of Copenhagen has proposed a polymer called peptide nucleic acid (PNA) as a precursor of RNA. Is this is where PNA comes in?

Exactly, PNA looks prebiotic. Currently that is the best alternative to ribose phosphate. Whether it was the original material or not is another issue.

Can you clarify one thing? Have all of the amino acids been synthesized in pre-biotic experiments, along with all the necessary components for making life?

Just turning on the spark in a basic pre-biotic experiment will yield 11 out of 20 amino acids. If you count asparagine and glutamine you get thirteen basic amino acids. We don't know how many amino acids there were to start with. Asparagine and glutamine, for example, do not look prebiotic because they hydrolyze. The purines and pyrimidines can alos be made, as can all of the sugars, although they are unstable.

Your original work was published only a month apart from Watson and Crick's description of the DNA molecule. How has the field of molecular biology influenced the field of exobiology?

The thing that has probably changed the outlook the most is the discovery of ribozymes, the catalytic RNA. This means you can have an organism with RNA carrying out both the genetic functions and catalytic functions. That gets around the problem of protein synthesis, which is this incredibly complicated thing. There is a problem with RNA as a prebiotic molecule because the ribose is unstable. This leads us to the pre-RNA world.
The idea of the pre-RNA world is essentially the same as the RNA world, except you have a different molecule that replicates. Another thing worth remembering is that all these pre-biotic experiments produce amino acids. To have these amino acids around and not use them in the first living organism would be odd. So the role of amino acids in the origin of life is unknown but still likely.

Tell us about your recent work and the lagoon idea.

The primitive Earth had big oceans, but it also had lakes, lagoons and beaches. Our hypothesis is that the conditions may have been ideal on these beaches or drying lagoons for prebiotic reactions to occur, for the simple reason that the chemicals were more concentrated in these sites than in the middle of the ocean.

Is this because of the temperatures and also the presence of minerals as well?

Temperature is an important factor. Minerals have been thought by some to play a role in the origin of life, but they really haven't done much for us so far. People talk about how minerals might have helped catalyze reactions, but there are few examples where the mineral makes any difference.
Our most recent research tackled the problem of making pyrimidines- uracil and cytosine, in prebiotic conditions. For some reason it just doesn't work very well under dilute conditions. We showed that it works like a charm once you get things concentrated and dry it out a bit. This changed my outlook on where to start looking for prebiotic reactions.
Another example is our work with co-enzyme A. The business end of co-enzyme A is called pantetheine. We showed you could make this under these kind of pre-biotic "dry beach" conditions. We found that you didn't need it to be very hot, you can make it at 40 degrees C. This indicates the ease with which some of this chemistry can take place.

Temperature seems to be a talking point regarding prebiotic hypotheses.

We know we can't have a very high temperature, because the organic materials would simply decompose. For example, ribose degrades in 73 minutes at high temperatures, so it doesn't seem likely. Then people talk about temperature gradients in the submarine vent. I don't know what these gradients are supposed to do. My thinking is that a temperature between 0 and 10 degrees C would be feasible. The minute you get above 25 degrees C there are problems of stability.

How does the discovery of the Martian meteorite factor in to the discussion? Are you convinced these are the fossilized remains of extraterrestrial microorganisms?

I think the data is interesting and suggestive, but not yet conclusive. Let's accept that the meteorite does come from Mars. You have apparently got very small bacterial fossils also iron sulfide and magnetite sitting next to each other. Then there are these PAHs (polycyclic aromatic hydrocarbons). All of this is suggestive but not compelling.
There are just two possibilities. Either there was life on Mars or there was not. I have no problem with the idea of life on Mars, the question remains whether this evidence is adequate. If it is correct, it has an implication for one of the big questions of prebiotic research. That is, is it easy or difficult to produce life from prebiotic compounds in prebiotic conditions? It seems that it would be difficult on Mars. If it turns out to be the case on Mars, where the conditions do not look very favorable, then it should apply to anywhere in the universe, or any planet with a suitable atmosphere and temperature.

Can you tell us about the field of exobiology today in context of the world of scientific research?

It is a very small field. There is a society, the International Society for the Study of the Origin of Life. It has only 300 members, a rather small society. My own lab is part of program called NSCORT (NASA Specialized Center of Research and Training). This program is conducted in close cooperation with NASA and supports five researchers along with graduate students, post-docs and undergraduate students.
The more important research are the experiments these days, rather than the trading of ideas. Good ideas are those that when reduced to an experiment end up working. Our approach is to do experiments and demonstrate things, not just talk about possibilities.

What advice do you have for students interested in pursuing studies in exobiology?

Well we are talking about solving chemical problems. Therefore a background in basic chemistry is essential along with knowledge in the fields of organic chemistry, biochemistry and some background in geology and physics. Exobiology is a small field with a lot of interaction. It is one of few fields where an undergraduate would be able to work with top people in the field almost immediately.
This interview was conducted in October, 1996

1. https://web.archive.org/web/20080518054852/http://www.accessexcellence.org/WN/NM/miller.php Taken from Leslie Orgel's Scientific American article "The Origin of Life on Earth" (Scientific American, October, 1994)
2. http://www.washington.edu/news/2013/12/12/scientists-discover-double-meaning-in-genetic-code/
3. https://www.academia.edu/1845973/How_the_discovery_of_ribozymes_cast_RNA_in_the_roles_of_both_chicken_and_egg_in_origin-of-life_theories?auto=download[/b]
4. http://pubs.acs.org/subscribe/archive/mdd/v04/i03/html/03timeline.html
5. Biology, Computing, and the History of Molecular Sequencing From Proteins to DNA, 1945–2000, page 21



Last edited by Admin on Wed Nov 29, 2017 12:08 pm; edited 32 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Current scientific models and attempts to explain the Origin of Life

There are various models and scenarios that could explain the origin of life. Each model represents a unique vision. Origin of life research has to provide explanations to abiotic synthesis of life’s building blocks (amino acids, peptides, ribose, nucleobases, fatty acids, nucleotides, and oligonucleotides), and their polymerizations to bio-macromolecules (peptides and oligonucleotides), and emergence of biological functions of replication and compartmentalization. where did life on Earth originate? To date, various environments have been proposed as plausible sites for life’s origin, including oceans, lakes, lagoons, tidal pools, submarine hydrothermal systems, etc. But no single setting can offer enough chemical and physical diversity of life to originate. 40 A coexisting atmosphere, water, and landmass with continuous material circulation between the three of them that is driven by the Sun. This setting is one of the minimum requirements for the emergence of life.

Life is generally characterized by the following three functions:
(1) compartmentalization: the ability to keep its components together and distinguish itself from the environment,
(2) replication: the ability to process and transmit heritable information to progeny, and
(3) metabolism: the ability to capture energy and material resources, staying away from thermodynamic equilibrium

All these functions are operated by biopolymers such as DNA, RNA, protein, and phospholipids. Phospholipids are made of two fatty acids esterified to a glycerol phosphate molecule. DNA and RNA are made of nucleosides (composed of (deoxy)ribose and nucleobases) bound by phosphodiester linkages, while proteins are made of amino acids linked together by peptide bonds. It is typically assumed that these vital components were synthesized abiotically, accumulated somewhere, condensed into polymers, interacted mutually, and eventually evolved into a self-sustaining system through natural phenomena on the primitive Earth.

The “Prebiotic soup” theory 40
Over time, philosophers and scientists have proposed many different theories for the origin of life. 
The best-known theory is the “Prebiotic soup” theory hypothesized by Oparin in 1924. In this theory, organic compounds were created in a reductive atmosphere from the action of sunlight and lightning. The compounds were then dissolved in the primitive ocean, concentrated, and underwent polymerization until they formed “coacervate” droplets. The droplets grew by fusion with other droplets, were split into daughter droplets by the action of tidal waves, and developed the ability to catalyze their own replication through natural selection, which eventually led to the emergence of life. Later on, the relevance of coacervates to the origin of life was questioned because coacervates have no permeability barrier, so they lack the capacity for nutrient uptake and waste release that are essential functions for encapsulated metabolism

Hydrothermal origin of life
The discovery of thermophilic organisms in association with deep-sea hydrothermal systems in the late 1970s led to a new idea that life might have originated in hydrothermal systems on the primitive Earth. The perceived benefits afforded to early life in this environment include protection from intense asteroid bombardment and UV radiation, and a source of thermal and chemical energy, along with potentially catalytic minerals. Evidence that supports this scenario has been provided by various research fields. For instance, geologists have detected evidence for microbial methanogenesis from fluid inclusions in hydrothermal precipitates. Using molecular biological approaches, biologists have demonstrated that the thermophilic microbial inhabitants of the active seafloor populate the deepest branches of the universal phylogenetic tree. Chemists have claimed that, on both theoretical and experimental bases, the physical and chemical conditions that are characteristic of the deep-sea hydrothermal systems are favorable for abiotic synthesis of biochemically significant organic molecules. More recently, a new type of vent system, the Lost City hydrothermal field, was discovered in 2000 more than 15 km from the spreading axis of the Mid-Atlantic Ridge. Unlike vent systems that are located directly on the spreading zone, the water circulating these off-axis vents makes no contact with magma, and emerges at a temperature of around 70e90 C. Its fluid composition is derived from exothermic reactions between seawater and uplifted mantle peridotite, rather than from interactions between seawater and cooling basalts. The peridotite-seawater reactions associated with the oxidation of iron produce alkaline fluids (pH 9e11) that are rich in H2 and CH4 and other low-molecular-mass hydrocarbons


Extraterrestrial origin of life
Another proposal of organic compounds on the primitive Earth is delivery by extraterrestrial objects (meteorites, comets, and interplanetary dust particles (IDPs)).  Carbonaceous chondrites contain a wide variety of organic compounds including amino acids, purines, pyrimidines, sugar-like compounds, and long-chain monocarboxylic acids with amphiphilic properties. These compounds could have been used as a component of primitive life.

Current origin of life proposals

Regularly science journals and papers come up with new OOL ( origin of life ) scenarios.

1. The Oparin-Haldane Hypothesis
In the early decades of the 20th century, Aleksandr Oparin (in 1924), and John Haldane (in 1929, before Oparin's first book was translated into English), independently suggested that if the primitive atmosphere was reducing (as opposed to oxygen-rich), and if there was an appropriate supply of energy, such as lightning or ultraviolet light, then a wide range of organic compounds might be synthesised.
Oparin suggested that the organic compounds could have undergone a series of reactions leading to more and more complex molecules. He proposed that the molecules formed colloid aggregates, or 'coacervates', in an aqueous environment. The coacervates were able to absorb and assimilate organic compounds from the environment in a way reminiscent of metabolism. They would have taken part in evolutionary processes, eventually leading to the first lifeforms.
Haldane's ideas about the origin of life were very similar to Oparin's. Haldane proposed that the primordial sea served as a vast chemical laboratory powered by solar energy. The atmosphere was oxygen free, and the combination of carbon dioxide, ammonia and ultraviolet radiation gave rise to a host of organic compounds. The sea became a 'hot dilute soup' containing large populations of organic monomers and polymers. Haldane envisaged that groups of monomers and polymers aquired lipid membranes, and that further developments eventually led to the first living cells.
Haldane coined the term 'prebiotic soup', and this became a powerful symbol of the Oparin-Haldane view of the origin of life.

2. Origin of Life: The Heterotroph Hypothesis
The anaerobic metabolic processes of the heterotrophs released carbon dioxide into the atmosphere, which allowed for the evolution of photosynthetic autotrophs, which could use light and CO2 to produce their own food. The autotrophs released oxygen into the atmosphere. For most of the original anaerobic heterotrophs, oxygen proved poisonous. The few heterotrophs that survived the change in environment generally evolved the capacity to carry out aerobic respiration. Over the subsequent billions of years, the aerobic autotrophs and heterotrophs became the dominant life-forms on the planet and evolved into all of the diversity of life now visible on Earth.

3. Origin of Life - The Sweet Crystal Hypothesis
When Cairns-Smith formulated his theory of crystalline ancestry - which accounts for the main mechanism by which life can form from inorganic precursors - he was percieved as not having provided a very detailed scenario for the introduction of organic material. Rather he showed how life can form, demonstrated that genetic takeovers were possible, illustrated that there would be selection pressure for carbon-based systems once they arose, and then suggested that the rest of the story was simply a matter for natural selection.
This state of affairs apparently left some of those who had not read Genetic Takeover unsatisfied. They felt as though the origin of their sort of life had not really been explained at all. They did not see where nucleic acid came from - and the origin of cell walls was still a mystery.
While some of the details have no-doubt been lost to history, it seems that some of the subsequent paths in the early evolution of organisms can be identified with a reasonable level of confidence. Even where this is not the case, it may prove helpful to identify in some detail at least one plausible scenario by which evolution can lead away from crystalline organisms, towards ones more easily recognisable as our ancestors.

4. Submarine hot springs and the origin of life
The discovery of hydrothermal vents at oceanic ridge crests and the appreciation of their importance in the element balance of the oceans is one of the main recent advances in marine geochemistry1. It is likely that vents were present in the oceans of the primitive Earth because the process of hydrothermal circulation probably began early in the Earth's history2.

5. Pyrite formation, the first energy source for life: a hypothesis

March 30, 1988
I here propose a new energy source for an autotrophic origin of life. It is the exergonic formation of pyrite from hydrogen sulfide and ferrous ions

6. Bubbles May Have Speeded Life's Origins on Earth
July 6, 1993
The role of bubbles in the creation of life on earth is one of the newest approaches to solving the scientific mystery that is probably second in importance only to the problem of how the universe itself began.
No one is suggesting that bubbles might explain everything. But in a new hypothesis receiving close attention, the multitudes of bubbles forming on the surface of the primordial seas must have collected chemicals and concentrated them for synthesis into complex molecules. Eventually, through multistage reactions constantly repeated by uncounted generations of bubbles, the molecules grew in size and ambition, ready for the transition to living, reproducing cells.

7. Thermoreduction, a hypothesis for the origin of prokaryotes
May 1995
All thermophiles discovered so far are prokaryotes (Bacteria or Archaea). Furthermore, reconstructions of rRNA phylogenies suggest that the progenitor of all prokaryotes was a thermophile. These data are usually interpreted as supporting the hypothesis that all present day organisms, including eukaryotes, originated from hyperthermophiles. However, this scenario is difficult to reconcile with the RNA world theory, considering the instability of RNA at very high temperatures, and it is also contradicted by the finding of sophisticated devices for thermophilic adaptation in present day hyperthermophiles.  

8. Organic Aerosols and the Origin of Life: An Hypothesis
February 2004
Recent experimental work has verified the prediction that marine aerosols could have an exterior film of amphiphiles; palmitic, stearic and oleic acids were predominant. Thermodynamic analysis has revealed that such aerosols are energetically capable of asymmetric division. In a prebiotic terrestrial environment, one of the products of such aerosol fission would have been bacterially sized (microns), the other would have been virally sized (tens of nanometers). Plausible avenues for chemical differentiation between the two particles are discussed, and the probabilities for the transition from geochemistry to biochemistry updated in light of recent palaeo fossil studies.

9. Hypothesis: the origin of life in a hydrogel environment
22 September 2004
A hypothesis is proposed that the first cell(s) on the Earth assembled in a hydrogel environment. Gel environments are capable of retaining water, oily hydrocarbons, solutes, and gas bubbles, and are capable of carrying out many functions, even in the absence of a membrane. Thus, the gel-like environment may have conferred distinct advantages for the assembly of the first cell(s).

10. The Origin Of Life Dual Origin Hypothesis
25 April 2005
According to the dual origin hypothesis, the cerebral cortex of higher mammals evolved from two primordial brain structures, the amygdala and hippocampal formation. This developmental process defines the orderly principles of cortical connectivity and gives rise to functionally distinct ventral and dorsal systems within the cerebrum. This paper reviews the basic features of the dual origin theory. This model is then applied to understanding symptom production in a number of psychiatric illnesses, with particular reference to recent structural and functional imaging studies. In this paper I propose that psychiatric symptoms can be conceptualized as arising from abnormal processing within dorsal (time-space-motility) or ventral (meaning-motivation) systems, or from a disturbance in the functional interaction/balance between them. Within this framework, one can identify symptom-specific correlations that cross-traditional diagnostic boundaries, as well as potential mechanisms that may explain biologically valid diagnostic entities. Integrating evolutionary, connectional and functional bases across multiple species, the dual origin hypothesis offers a powerful neural systems model to help organize our understanding of psychiatric illness, therein suggesting novel approaches to diagnosis, prevention and treatment.
https://www.ncbi.nlm.nih.gov/pubmed/16356547

11. The origins of life -- the 'protein interaction world' hypothesis: protein interactions were the first form of self-reproducing life and nucleic acids evolved later as memory molecules
26 December 2005
The 'protein interaction world' (PIW) hypothesis of the origins of life assumes that life emerged as a self-reproducing and expanding system of protein interactions. In mainstream molecular biology, 'replication' refers to the material copying of molecules such as nucleic acids. However, PIW is conceptualized as an abstract communication system constituted by the interactions between proteins, in which 'replication' happens at the level of self-reproduction of these interactions between proteins.

12. The Emergence of Cells During the Origin of Life
08 Dec 2006:
simple physicochemical properties of elementary protocells can give rise to essential cellular behaviors, including primitive forms of Darwinian competition and energy storage. Such preexisting, cooperative interactions between the membrane and encapsulated contents could greatly simplify the transition from replicating molecules to true cells. They also suggest intriguing possibilities for further investigation. For example, a corollary of vesicle competition is that a charged genetic polymer, such as nucleic acid, would be much more effective at driving membrane uptake than an electrically neutral polymer, because most of the osmotic pressure is due to counterions associated with the charged polymer. Could this influence the natural selection of the genetic material itself? Furthermore, competition for membrane molecules would favor stabilized membranes, suggesting a selective advantage for the evolution of cross-linked fatty acids (e.g., di- and triglycerides) and even the phospholipids of today. Greater membrane stability leads to decreased dynamics, however, and the evolutionary solutions to this problem (e.g., permeases, synthetic enzymes) could cause a “snowball” effect on the complexity of early life (16). Exploration of these minimal systems promises to lead to more exciting insights into the origins of biological complexity.

13.  Primordial Soup's On: Scientists Repeat Evolution's Most Famous Experiment
March 28, 2007
many scientists have had doubts that the environment assumed in the Miller-Urey experiment was truly representative of the early earth's environment, since nitrites, for instance, would likely have neutralized any resulting biochemical compounds. In 2007, biochemist Jeffrey Bada, noting that significant amounts of iron and carbonate minerals were likely present in the early atmosphere, conjectured that these compounds may have neutralized the deleterious effects of the nitrites. To test this hypothesis, Jeffrey Bada performed a new Miller-Urey-type experiment by adding iron and carbonate minerals. As in the original experiment, Bada found numerous amino acids in the resulting mixture. Thus the basic findings of the Miller-Urey experiment might still have validity in spite of the nitrite problem

14. Chemist Shows How RNA Can Be the Starting Point for Life
MAY 13, 2009
In May 2009, a team led by John Sutherland, a chemist at the University of Manchester in England, solved a problem that has perplexed researchers for at least 20 years (see above), namely how the basic nucleotides (building blocks) of RNA could spontaneously assemble. As recently as a few years ago, the appearance of these nucleotides on the primitive earth was thought to be a "near miracle." In the 2009 study, Sutherland and his team used the same starting chemicals that have been employed in numerous earlier experiments, but they tried many different orders and combinations. They finally discovered one order and combination that formed the RNA nucleotide ribocytidine phosphate. What's more, when the mixture was exposed to ultraviolet light, a second nucleotide of RNA was formed. Two other nucleotides remain, but the synthesis of the first two was thought to be more difficult

15. The Zinc world hypothesis
24 August 2009
The suggested "Zn world" scenario identifies the geological conditions under which photosynthesizing ZnS edifices of hydrothermal origin could emerge and persist on primordial Earth, includes a mechanism of the transient storage and utilization of solar light for the production of diverse organic compounds, and identifies the driving forces and selective factors that could have promoted the transition from the first simple, photostable polymers to more complex living organisms.

16. Origin of life: Adding UV light helps form 'Missing G' of RNA building blocks
June 15, 2010
A team of researchers at the Georgia Institute of Technology and the University of Roma La Sapienza succeeded in synthesizing guanine, one of the four bases of RNA. The other three, adenine, cytosine and uracil, have previously been synthesized. The researchers were able to form guanine by subjecting a solution of formamide (H2NCOH), a simple compound that often has been suggested as a starting material for biotic compounds, to ultraviolet radiation during heating. Thomas Orlando, one of the researchers, explained, "Our model prebiotic reaction is attractive because most aspects of the process were likely to occur on the early Earth and it reduces chemical constraints."

17. Thermodynamic origin of life
9 September 2010
Understanding the thermodynamic function of life may shed light on its origin. Life, as are all irreversible processes, is contingent on entropy production. Entropy production is a measure of the rate of the tendency of Nature to explore available microstates. The most important irreversible process generating entropy in the biosphere, and thus facilitating this exploration, is the absorption and transformation of sunlight into heat. Here we hypothesize that life began, and persists today, as a catalyst for the absorption and dissipation of sunlight at the surface of shallow seas. The resulting heat is then efficiently harvested by other irreversible processes such as the water cycle, hurricanes, and ocean and wind currents. RNA and DNA are the most efficient of all known molecules for absorbing the intense ultraviolet light that could have penetrated the dense early atmosphere, and are remarkably rapid in transforming this light into heat in the presence of liquid water. From this perspective, the origin and evolution of life, inseparable from water and the water cycle, can be understood as resulting from the natural thermodynamic imperative of increasing the entropy production of the Earth in its interaction with its solar environment. A mechanism is proposed for the reproduction of RNA and DNA without the need for enzymes, promoted instead through UV light dissipation and the ambient conditions of prebiotic Earth.

18. Asteroids make life’s raw materials
4 May 2011
researchers in Italy found that if they mixed formamide, a simple chemical present in space, with material from a meteorite, and then heated the mixture, that they produced nucleic acids (building blocks of DNA and RNA), the amino acid glycine, and a precursor to sugar. The team also found that the meteorite mineral stabilized RNA, which is otherwise broken down with water

19. Thermodynamic dissipation theory for the origin of life
11 March 2011
Understanding the thermodynamic function of life may shed light on its origin. Life, as are all irreversible processes, is contingent on entropy production. Entropy production is a measure of the rate of the tendency of Nature
to explore available microstates. The most important irreversible process generating entropy in the biosphere and, thus, facilitating this exploration, is the absorption and transformation of sunlight into heat. Here we hypothesize that life began, and persists today, as a catalyst for the absorption and dissipation of sunlight on the surface of Archean seas. The resulting heat could then be efficiently harvested by other irreversible processes such as the water cycle, hurricanes, and ocean and wind currents. RNA and DNA are the most efficient of all known molecules for absorbing the intense ultraviolet light that penetrated the dense early atmosphere and are remarkably rapid in transforming this light into heat in the presence of liquid water. From this perspective, the origin and evolution of life, inseparable from water and the water cycle, can be understood as resulting from the natural thermodynamic imperative of increasing the entropy production of the Earth in its interaction with its solar environment. A mechanism is proposed for the reproduction of RNA and DNA without the need for enzymes, promoted instead through UV light dissipation and diurnal temperature cycling of the Archean sea-surface.

20.  First glimpse at the viral birth of DNA
18 April 2012
Researchers found viruses in a hot, acidic lake in Lassen Volcanic National Park in California containing both a RNA-derived gene and a gene for DNA replication, typical of a DNA virus. This lends support to the hypothesis that viruses performed the transfer of genetic information from RNA to DNA during the earliest epoch of life on earth

21. Self-Assembling Molecules Offer New Clues on Life's Possible Origin
Feb. 11, 2013
One aspect of the "RNA world" hypothesis that heretofore has stymied researchers is the difficulty in demonstrating that RNA molecules or components could form long, information-rich chains, in water solutions. In February 2013, a team of researchers at the Georgia Institute of Technology and the Institute for Research in Biomedicine in Barcelona, Spain announced that by giving a component of RNA known as TAP a "tail," these units become "rosettes" that spontaneously form chains in water, like a large stack of plates, up to 18,000 units long. "The nice thing [about this study] is this is a demonstration of self-assembly in water," noted Ramanarayanan Krishnamurthy, a chemist at the Scripps Research Institute in California. The next step will be to see whether such assemblies can encode information, as one possible chemical route to the origin of life

22. Molecules assemble in water, hint at origins of life
February 20, 2013
Researchers are exploring an alternate theory for the origin of RNA: they think the RNA bases may have evolved from a pair of molecules distinct from the bases we have today. This theory looks increasingly attractive, as researchers were able to achieve efficient, highly ordered self-assembly in water with small molecules that are similar to the bases of RNA.

23. Did Life on Earth Come From Mars?
SEPTEMBER 5, 2013
In August 2013, two separate developments caught the interest of many who have speculated that perhaps life on earth really started on Mars. Steven Brenner, an origin-of-life researcher at the Westheimer Institute in Florida, announced his finding that boron and molybdenum stabilize the formation of RNA in the presence of water, and thus may well have been key to the original formation of RNA. The early earth did not have much of either element, but both appear to have been more abundant on Mars billions of years ago. In a separate finding, a few days later, a team led by Christopher Adcock of the University of Nevada, Las Vegas, announced their finding that phosphates (which are an essential component of life) were also more abundant on Mars -- in particular, the Martian phosphate compounds are far more soluble in water than were the phosphates on the early earth. For details on both studies, see

24. Spark of life: Metabolism appears in lab without cells
25 April 2014
Researchers at the University of Cambridge announced that they had found that the formation of metabolic processes, key to all life and a major gap in understanding the origin of life, could have occurred spontaneously in the earth's early oceans, catalyzed by metal ions rather than enzymes, as they are in cells today. This suggests that life may have arisen metabolically first, then generated RNA later

25. Formation of life’s building blocks recreated in lab
8 Dec 2014
Researchers at the Academy of Sciences in Prague fired a high-powered laser (simulating a meteorite impact) at samples of formamide, a liquid that would have been plentiful on the early earth. They found that all four RNA bases (adenine, guanine, cytosine and uracil), three of which are also in DNA, had been formed in the reaction

26. The [GADV]‐protein world hypothesis
2015 Jan 16
Based on the fact that RNA has not only a genetic function but also a catalytic function, the RNA world theory on the origin of life was first proposed about 20 years ago. The theory assumes that RNA was amplified by self-replication to increase RNA diversity on the primitive earth. Since then, the theory has been widely accepted as the most likely explanation for the emergence of life. In contrast, we reached another hypothesis, the [GADV]-protein world hypothesis, which is based on pseudo-replication o [GADV]-proteins. We reached this hypothesis during studies on the origins of genes and the genetic code, where [G], [A], [D], and [V] refer to Gly, Ala, Asp, and Val, respectively. In this review, possible steps to the emergence of life are discussed from the standpoint of the [GADV]-protein world hypothesis, comparing it in parallel with the RNA world theory. It is also shown that [GADV]-peptides, which were produced by repeated dry-heating cycles and by solid phase peptide synthesis, have catalytic activities, hydrolyzing peptide bonds in a natural protein, bovine serum albumin. These experimental results support the [GADV]-protein world hypothesis for the origin of life.

27. Meteorite Chemicals May Have Started Life on Earth—and Space
April 16, 2015
The molecules that kick-started life on primordial Earth could have been made in space and delivered by meteorites, according to researchers in Italy. The group synthesised sugars, amino acids and nucleobases with nothing more than formamide, meteorite material and the power of a simulated solar wind, replicating a process they believe cooked up a prebiotic soup long before life existed on Earth.

28. Primordial soup hypothesis
March 24, 2016
Life on Earth began more than 3 billion years ago, evolving from the most basic of microbes into a dazzling array of complexity over time. But how did the first organisms on the only known home to life in the universe develop from the primordial soup? One theory involved a "shocking" start. Another idea is utterly chilling. And one theory is out of this world! Inside you'll learn just how mysterious this all is, as we reveal the different scientific theories on the origins of life on Earth.

29. ‘RNA world’ inches closer to explaining origins of life
May. 12, 2016
Sutherland's group has been successful in synthesizing two of the four nucleotides of RNA. In May 2016, a team led by Thomas Carell, a chemist at Ludwig Maximilian University of Munich in Germany, succeeded in synthesizing purine, one of the remaining nucleotides. What's more, the process they discovered was remarkably simple, involving chemicals known to exist on the early earth. One problem was that Carell needed to find a way to stop all but one critical amine from reacting on a aminopyrimidines molecule. But they found that the presence of a mild acid did the job, and the one amine that remained was exactly the one that forms purine

30. Hydrothermal vent models transform the origins of life from unlikely to near-inevitable
JUNE 23, 2016
Evolution only seems to move toward greater order; in the larger scheme, it’s downhill all the way. Vent models posit that given the initial conditions, the emergence of life was not a near-miracle. It was inevitable. 

31. Electric Spark hypothesis 
March 24, 2016
Life on Earth began more than 3 billion years ago, evolving from the most basic of microbes into a dazzling array of complexity over time. But how did the first organisms on the only known home to life in the universe develop from the primordial soup? One theory involved a "shocking" start. Another idea is utterly chilling. And one theory is out of this world! Inside you'll learn just how mysterious this all is, as we reveal the different scientific theories on the origins of life on Earth.
Lightning may have provided the spark needed for life to begin.
Electric sparks can generate amino acids and sugars from an atmosphere loaded with water, methane, ammonia and hydrogen, as was shown in the famous Miller-Urey experiment reported in 1953, suggesting that lightning might have helped create the key building blocks of life on Earth in its early days. Over millions of years, larger and more complex molecules could form. Although research since then has revealed the early atmosphere of Earth was actually hydrogen-poor, scientists have suggested that volcanic clouds in the early atmosphere might have held methane, ammonia and hydrogen and been filled with lightning as well.
Or could simple clay have fueled life’s beginning? Read on to find out.
Electric Spark Lightning may have provided the spark needed for life to begin. Electric sparks can generate amino acids and sugars from an atmosphere loaded with water, methane, ammonia and hydrogen, as was shown in the famous Miller-Urey experiment reported in 1953, suggesting that lightning might have helped create the key building blocks of life on Earth in its early days. Over millions of years, larger and more complex molecules could form. Although research since then has revealed the early atmosphere of Earth was actually hydrogen-poor, scientists have suggested that volcanic clouds in the early atmosphere might have held methane, ammonia and hydrogen and been filled with lightning as well. Or could simple clay have fueled life’s beginning? Read on to find out.

32. The minimotif synthesis hypothesis for the origin of life
2016 Jul 19
Several theories for the origin of life have gained widespread acceptance, led by primordial soup, chemical evolution, metabolism first, and the RNA world. However, while new and existing theories often address a key step, there is less focus on a comprehensive abiogenic continuum leading to the last universal common ancestor. Herein, I present the “minimotif synthesis” hypothesis unifying select origin of life theories with new and revised steps. The hypothesis is based on first principles, on the concept of selection over long time scales, and on a stepwise progression toward complexity. The major steps are the thermodynamically-driven origination of extant molecular specificity emerging from primordial soup leading to the rise of peptide catalysts, and a cyclic feed-forward catalytic diversification of compounds and peptides in the primordial soup. This is followed by degenerate, semi-partially conservative peptide replication to pass on catalytic knowledge to progeny protocells. At some point during this progression, the emergence of RNA and selection could drive the separation of catalytic and genetic functions, allowing peptides and proteins to permeate the catalytic space, and RNA to encode higher fidelity information transfer. Translation may have emerged from RNA template driven organization and successive ligation of activated amino acids as a predecessor to translation.

33. Our last common ancestor inhaled hydrogen from underwater volcanoes
Jul. 25, 2016
Researchers at Heinrich Heine University in Dusseldorf, Germany searched DNA databases for gene families shared by at least two species of bacteria and two archaea (even more primitive biological organisms). After analyzing millions of genes and gene families, they found that only 355 gene families are truly shared across all modern organisms, and thus are the most probable genes shared by the "last universal common ancestor" (LUCA) of life. Further, these researchers found that the probable LUCA organism was an anerobe, namely it grew in an evironment devoid of oxygen. These results suggest that LUCA originated near undersea volcanoes

34. Scientists take big step toward recreating primordial 'RNA world' of 4 billion years ago
August 15, 2016
Researchers at the Scripps Research Institute created a ribozyme (a special RNA enzyme) that can both amplify genetic information and generate functional molecules. In particular, it can efficiently replicate short segments of RNA and can transcribe longer RNA segments to make functional RNA molecules with complex strictures. These features are close to what scientists envision was an RNA replicator that could have supported life on the very early earth, before the emergence of current biology, where protein enzymes handle gene replication and transcription

35. The Emergence of Life as a First-Order Phase Transition
March 1, 2017
Here we present a model for the emergence of life in which replicators are explicitly coupled to their environment through the recycling of a finite supply of resources. The model exhibits a dynamic, first-order phase transition from nonlife to life, where the life phase is distinguished by selection on replicators. We show that environmental coupling plays an important role in the dynamics of the transition. The transition corresponds to a redistribution of matter in replicators and their environment, driven by selection on replicators, exhibiting an explosive growth in diversity as replicators are selected.

36. Life on Earth may have begun as dividing droplets
MARCH 21, 2017
In a primordial soup on ancient Earth, droplets of chemicals may have paved the way for the first cells. Shape-shifting droplets split, grow and split again in new computer simulations. The result indicates that simple chemical blobs can exhibit replication, one of the most basic properties of life, physicist Rabea Seyboldt of the Max Planck Institute for the Physics of Complex Systems in Dresden, Germany, reported March 16 at a meeting of the American Physical Society.
Within a liquid, small droplets of particular chemicals can separate out, like beads of oil in water. Such globules typically remain spherical, growing as they merge with other drops. But in simulations, Seyboldt and colleagues found that droplets might behave in a counterintuitive way under certain conditions, elongating and eventually dividing into two.

37. NASA Has Found The Ingredients For Life On Saturn’s Moon Enceladus
April 13, 2017
(Reuters) – Ice plumes shooting into space from Saturn’s ocean-bearing moon Enceladus contain hydrogen from hydrothermal vents, an environment that some scientists believe led to the rise of life on Earth, research published on Thursday showed.The discovery makes Enceladus the only place beyond Earth where scientists have found direct evidence of a possible energy source for life, according to the findings in the journal Science.Similar conditions, in which hot rocks meet ocean water, may have been the cradle for the appearance of microbial life on Earth more than 4 billion years ago.



38. Chemists may be zeroing in on chemical reactions that sparked the first life
May. 19, 2017 
DNA is better known, but many researchers today believe that life on Earth got started with its cousin RNA, because that nucleic acid can act as both a repository of genetic information and a catalyst to speed up biochemical reactions. But those favoring this “RNA world” hypothesis have struggled for decades to explain how the molecule’s four building blocks could have arisen from the simpler compounds present during our planet’s early days. Now, chemists have identified simple reactions that, using the raw materials on early Earth, can synthesize close cousins of all four building blocks. The resemblance isn’t perfect, but it suggests scientists may be closing in on a plausible scenario for how life on Earth began.
RNA’s four building blocks are called nucleotides. Each is composed of ribose, a ring-shaped sugar molecule, connected to one of four different ring-shaped “bases,” adenine (A), guanine (G), cytosine (C), and uracil (U). C and U are structurally similar to each other and collectively known as pyrimidines, whereas A and G resemble each other and are known as purines. In 2009, researchers led by Matthew Powner and John Sutherland at the Medical Research Council in Cambridge, U.K., came up with the first plausible chemical reactions that could have synthesized pyrimidines on early Earth. But very different reactions, in different conditions, seemed necessary to make purines. That begged the question of how all four nucleotides could have wound up in the same place to give rise to the first “living” RNA molecules.

39. Foldamer hypothesis for the growth and sequence differentiation of prebiotic polymers
July 10, 2017
It is not known how life originated. It is thought that prebiotic processes were able to synthesize short random polymers. However, then, how do short-chain molecules spontaneously grow longer? Also, how would random chains grow more informational and become autocatalytic (i.e., increasing their own concentrations)? We study the folding and binding of random sequences of hydrophobic (HH) and polar (PP) monomers in a computational model. We find that even short hydrophobic polar (HP) chains can collapse into relatively compact structures, exposing hydrophobic surfaces. In this way, they act as primitive versions of today’s protein catalysts, elongating other such HP polymers as ribosomes would now do. Such foldamer catalysts are shown to form an autocatalytic set, through which short chains grow into longer chains that have particular sequences. An attractive feature of this model is that it does not overconverge to a single solution; it gives ensembles that could further evolve under selection. This mechanism describes how specific sequences and conformations could contribute to the chemistry-to-biology (CTB) transition.

1. http://www.simsoup.info/Origin_Landmarks_Oparin_Haldane.html
2. http://www.sparknotes.com/testprep/books/sat2/biology/chapter8section1.rhtml
3. http://originoflife.net/sweet_crystal/
4. https://arxiv.org/pdf/0907.0042.pdf
5. http://sci-hub.bz/http://www.sciencedirect.com/science/article/pii/S0723202088800018
6. http://www.nytimes.com/1993/07/06/science/bubbles-may-have-speeded-life-s-origins-on-earth.html?pagewanted=all
7. https://www.researchgate.net/profile/Patrick_Forterre2/publication/15551510_Thermoreduction_a_hypothesis_for_the_origin_of_prokaryotes/links/0f317536bc0eb3e30e000000.pdf
8. https://www.livescience.com/13363-7-theories-origin-life.html
9. https://www.livescience.com/13363-7-theories-origin-life.html
10. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5223774/
11. http://origin-life.gr.jp/3401/peter/3401040.pdf
12. http://science.sciencemag.org/content/314/5805/1558.full
[/size]13. https://www.scientificamerican.com/article/primordial-soup-urey-miller-evolution-experiment-repeated/
14. http://www.nytimes.com/2009/05/14/science/14rna.html
15. http://www.earth-syst-dynam.net/2/37/2011/esd-2-37-2011.pdf
16. https://www.sciencedaily.com/releases/2010/06/100614101957.htm
17. https://www.nature.com/articles/334609a0
18. https://www.newscientist.com/article/mg21028114.000-asteroids-make-lifes-raw-materials/
19. https://biologydirect.biomedcentral.com/articles/10.1186/1745-6150-4-26
20. https://www.newscientist.com/article/mg21428613.500-first-glimpse-at-the-viral-birth-of-dna/
21. http://www.sciencemag.org/news/2013/02/self-assembling-molecules-offer-new-clues-lifes-possible-origin
22. https://www.sciencedaily.com/releases/2013/02/130220123332.htm
23. https://news.nationalgeographic.com/news/2013/09/130905-mars-origin-of-life-earth-panspermia-astrobiology/
24. https://www.newscientist.com/article/dn25471-spark-of-life-metabolism-appears-in-lab-without-cells/
25. https://www.newscientist.com/article/dn26672-formation-of-lifes-building-blocks-recreated-in-lab/
26. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4428654/
27. https://www.scientificamerican.com/article/meteorite-chemicals-may-have-started-life-on-earth-and-space/
28. http://link.springer.com.ololo.sci-hub.cc/article/10.1023%2FB%3AORIG.0000009828.40846.b3?LI=true
29. http://www.sciencemag.org/news/2016/05/rna-world-inches-closer-explaining-origins-life
30. [size=12][size=13]https://www.sciencenews.org/article/life-earth-may-have-begun-dividing-droplets?tgt=nr[/size][/size]
31. http://www.sciencedirect.com.sci-hub.cc/science/article/pii/S0079610704000999
32. https://sci-hub.bz/http://www.sciencedirect.com/science/article/pii/S0149763405001454
33. http://www.sciencemag.org/news/2016/07/our-last-common-ancestor-inhaled-hydrogen-underwater-volcanoes
34. https://www.sciencedaily.com/releases/2016/08/160815185822.htm
35. http://online.liebertpub.com/doi/abs/10.1089/ast.2016.1481?journalCode=ast&#utm_source=ETOC&utm_medium=email&utm_campaign=as
36. http://www.sciencedirect.com.sci-hub.cc/science/article/pii/S0723202088800018
37. https://www.washingtonpost.com/news/speaking-of-science/wp/2017/04/13/nasa-finds-ingredients-for-life-spewing-out-of-saturns-moon/?utm_term=.2f3dd26bda31
38. http://www.sciencemag.org/news/2017/05/chemists-may-be-zeroing-chemical-reactions-sparked-first-life
39. http://www.pnas.org/content/114/36/E7460.full
40. http://sci-hub.bz/https://www.sciencedirect.com/science/article/pii/S1674987117301305



Last edited by Admin on Mon Dec 04, 2017 12:42 am; edited 11 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Current scientific transition proposals from a supposed "progenote" to the last universal common ancestor (LUCA)

Life is the most intricate and complex phenomenon known to science. 12 The origins of life stands among the great open scientific questions of our time. 13

It is commonly held that the last universal common ancestor (LUCA) was not the first life, but that there was a transition between a so-called " progenote ", which represents the first life, and LUCA. There is no consensus about the constitution of the progenote, and various descriptions have been brought forward:  

The current literature uses the term progenote in two different ways:
1) it signifies an organizational level in evolution when prokaryotic organization preceded cells; or
2) it is used to denote the last common ancestor of all extant life. In some scenarios that describe early cellular evolution, it was assumed that the last common ancestor was at a pre prokaryotic level of organization; however, subsequent analyses of the molecular evolution of different cellular components suggest that the last common ancestor was a prokaryote. Based on this realization, the term progenote should be more properly used to denote a hypothetical preprokaryotic stage in cellular evolution, distinct from the last common ancestor. 6

The progenote is a hypothetical candidate for the last universal cellular ancestor. 7 There are two major conjectures associated with this entity:

(1) the progenote's genome is based on RNA rather than DNA and
(2) the replication, transcription and translation of this RNA organism had a much higher error rate than the ensuing DNA‐based cells.

The universal ancestor 11
Carl Woese,  June 9, 1998
Entities in which translation had not yet developed to the point that proteins of the modern type could arise have been termed “progenotes,” and the era during which these were the most advanced forms of life, the “progenote era”
For Carl Woese, a motivating belief was that major structural and functional differences between the translational machineries of Bacteria, Archaea and eukaryotes reflect different solutions to problems of translational accuracy and efficiency as yet only partially solved in their common ancestor. That ancestor was thus more primitive than any contemporary pro- or eukaryote  Woese & Fox called it ‘the progenote’. 4 When one looks at the eukaryotic cell in molecular detail, at its nuclear organization—control mechanisms, introns and so on— it feels in a way less, not more, advanced than its prokaryotic counterparts—less streamlined, less straightforwardly controlled. In fact, one might profitably consider that the urcaryote [the earliest eukaryote] in ways resembles the progenote more than do prokaryotes. I would like to suggest that the eukaryotic cell evolved from the progenote at a somewhat later time than did its prokaryotic counterparts and that this is, in fact, responsible for the origin of the nucleus.  If modern large proteins could not be produced by progenotes, then a modern type of genome replication/repair mechanism did not exist. As with translation, a rudimentary mechanism implies a less accurate one, and the resulting high mutation rates necessitated small genomes. The structure of these genomes must reflect the primitive evolutionary dynamic in general. Therefore, I see the progenote genome as organized rather like the macronucleus of some ciliates today: it comprised many small linear chromosomes (mini-chromosomes), each present in multiple copies. Each chromosome was “operonally” organized, that is, functionally or structurally related genes were grouped together. The individual chromosomes were “semi-autonomous” in the sense that they more resembled mobile genetic elements than typical modern chromosomes. Cell division occurred in the simplest way possible, by a physical pinching of the cell into two approximately equal halves. 

Progenotes Become Genotes. At these early stages of life, everything turned upon the evolution of translation. Each slight improvement in that process, each increase in its accuracy, would have permitted a new generation of proteins to emerge. These new proteins, in turn, refined and developed the metabolic pathways and generally improved the cell, which then set the stage for a further round of improvement in translation. In this way, wave after wave of innovation occurred, each triggered by a refinement in translation and spread throughout the community by lateral gene transfer. This iterative, bootstrapping evolution continued until the accuracy of translation reached a level where it no longer prevented the evolution of the types of proteins we see today. The evolutionary dynamic then ceased to be constrained by imprecise translation, and progenotes, by definition, became genotes. This transition did not mean that translation had stopped evolving, nor did it mean that the initial genotes were modern types of cells. That latter development required many more innovations and refinements.

I cannot see anything besides baseless speculations here, without a shred of evidence to back up the ideas and scenarios.

Opinion: Studies on the origin of life — the end of the beginning 3
John D. Sutherland 18 January 2017
Understanding how life on Earth might have originated is the major goal of origins of life chemistry. To proceed from simple feedstock molecules and energy sources to a living system requires extensive synthesis and coordinated assembly to occur over numerous steps, which are governed only by environmental factors and inherent chemical reactivity. 3 for what turned out to be purely chemical reasons, albeit elegantly subtle ones — then it could be a recapitulation of the way that natural life originated. We are not yet close to achieving this.  Broadly speaking, the origin of life can be approached by thinking from biology down or from chemistry up1. From biology down, phylogenetic analysis of gene sequences can be used to plumb the depths and deduce the general nature of the last universal common ancestor (LUCA) of cellular life from its catalog of genes, but just how relevant is this to the actual origin of life? The latest list of genes thought to be present in LUCA is a long one. The presence of membranes, proteins, RNA and DNA, the ability to perform replication, transcription and translation, as well as harbouring an extensive metabolism driven by energy harvested from ion gradients using ATP synthase, reveal that there must have been a vast amount of evolutionary innovation between the origin of life and the appearance of LUCA.

Many of the inferred proteins in LUCA use FeS clusters and other transition-metal-ion-based co-factors; thus, Biology almost always relies on chemistry that does not proceed efficiently in the absence of catalysis, because this allows chemistry to be regulated by dialing various catalysts up or down. However, most prebiotic chemistry must proceed of its own accord, and this surely suggests that it must generally be different from the underlying chemistry used in biology (although this is not invariably the case; for example, the dismutation of 6,7-Dimethyl-8-ribityllumazine  can proceed efficiently in the absence of enzymatic catalysis. Nevertheless, despite the inevitable widespread differences between their individual reactions, prebiotic reaction networks ultimately have to transition into biochemical networks; hence, there must be some similarities between the two, if only at the level that practitioners of synthesis would view as strategic. 

There is indeed a HUGE UNBRIDGEABLE GAP between the two.


Despite the inevitable widespread differences between their individual reactions, prebiotic reaction networks ultimately have to transition into biochemical networks; hence, there must be some similarities between the two, if only at the level that practitioners of synthesis would view as strategic.

By approaching the origin of life from chemistry up, there have to be constraints as to what are plausible starting materials and reaction conditions, but defining these constraints can be difficult because of our uncertainties concerning early Earth geochemistry. Synthesis inevitably has to play a major part, but it has to somehow be controlled and coordinated if mixtures of just the right complexity to progress towards life are to be produced. High energy, non-selective chemistry might appear appealing at first, because many (proto-)biomolecules can be produced in one step — especially if one is prepared to analyze down to the parts per million level — but myriad by-products make their subsequent separation or selective utilization seem impossibly difficult. More plausibly, certain inherently favored reactions or sequences of reactions might selectively produce key molecules destined for biology. If this were the case, then it should be discoverable through experimental investigation. Accordingly, several years ago, we set out to use experimental chemistry to address two questions. First, are completely different chemistries needed to make the various subsystems? Second, would these chemistries be compatible with each other? Our goal was to investigate the synthesis of nucleotides, amino acids, lipids and other cellular components from simple feedstocks under prebiotically an environment that could furnish these inorganic components is circumstantially implicated. 

It seems unlikely that the earliest evolutionary wonders of biology were all discovered simultaneously. 

The author commits two fallacies in one sentence. First, there was no evolution prior DNA replication. The only alternative mechanism to intelligent implantation is unguided, random chemical reactions. Secondly, " discovering " implies teleology, which is tabu. 

A stepwise process seems much more plausible, but for each innovation to be retained against the otherwise inexorable drift towards equilibrium, energy would have to be expended endlessly. 

That's a self-defeating sentence. If thermodynamics argue against such processes, why are stepwise processes more plausible? Isn't it rather, that once design is discarded, there can ONLY be stepwise processes, since assembly all at once is not how natural mechanisms operate? Isn't it that the naturalistic framework and a priori thinking is producing its bitter fruits here? 

Combining these ideas with the concept that aliveness need not be all or nothing leads to a diagrammatic depiction that we have found useful to collect and direct our thoughts: 

Tempo, Mode, the Progenote, and the Universal Root 10
1995
Woese felt that the differences between archaebacteria and either eubacteria or eukaryotes were of a sufficiently fundamental nature to indicate that all three primary kingdoms must have begun to diverge during the period of progressive evolution from a progenote. But there was no way to decide the order of branching—whether the first divergence in the universal tree separated (i) eubacteria from a line that was to produce archaebacteria and eukaryotes, or (ii) a proto-eukaryotic lineage from a fully prokaryotic (eubacterial and archaebacterial) clade, or (iii) the (the third and least popular possibility) archaebacteria from eukaryotes and eubacteria. 

There is in fact in principle no way to decide this or to root such a universal tree based only on a collection of homologous sequences. A solution to this problem was proposed and implemented by Iwabe and colleagues (Iwabe et al., 1989), in 1989. Although there can be no organism that is an outgroup for a tree relating all organisms, we can root an all-organism tree based on the sequences of outgroup genes produced by gene duplication prior to the time of the cenancestor.

In 1990, Woese, Kandler and Wheelis incorporated the Iwabe rooting in a new and broader exegesis on the significance of the tripartite division of the living world . This treatment elevated the rank of the three primary kingdoms to "domains" (since kingdom status was already well accepted for animals, plants, and fungi within the eukaryotes) and renamed them Bacteria, Archaea, and Eucarya.

The root of the universal tree is still "up in the air," and we don't know as much about the cenancestor as we had hoped. Why is this? One possibility is that we are pushing molecular phylogenetic methods to their limits: although we have reasonable ways of assessing how well any given tree is supported by the data on which it is based, methods for determining the likelihood that this is the "true tree" are poorly developed. The issue is whether the last common ancestor of all life, the cenancestor , was a primitive entity, a progenote, with a more rudimentary genetic information-transfer system. Thinking on this issue is still unsettled. Much depends on the placement of the root of the universal tree and on whether or not lateral transfer renders such rooting meaningless.

Since the reclassification of all life forms in three Domains (Archaea, Bacteria, Eukarya), the identity of their alleged forerunner (Last Universal Common Ancestor or LUCA) has been the subject of extensive controversies: progenote or already complex organism, prokaryote or protoeukaryote, thermophile or mesophile, product of a protracted progression from simple replicators to complex cells or born in the cradle of "catalytically closed" entities? LUCA may be understood as a diverse community of already metabolically and genetically sophisticated organisms. Its predecessor the progenote, more primitive and modular, was also a heterogeneous and diverse community of cells engaged in the emergence of a genetic code 1

The emergence of self-replicating entities of increasing complexity requires both the formation of compartments (without which no distinction can be made between genotype and phenotype, and parasitic molecules cannot be removed) and an ambient metabolism from which to draw renewable building blocks; such a metabolism, therefore, should be self-sustaining to a certain extent; de Duve and Wachtershauser  have presented different versions of dynamic, evolving and self-sustaining metabolic networks.

The term progenote is often used in the sense of progenitor to denote the last common ancestor of archea, bacteria, and eukaryotes, not in the intended sense as a contrast to genote or Eugene, that is, organisms that have a “precise, accurate link between genotype and phenotype”

The difficulty of the problem cannot be overestimated. Indeed, all known cells are complex and elaborately organized. The simplest known cellular life forms, the bacterial (and the only known archaeal) parasites and symbionts, clearly evolved by degradation of more complex organisms; 

That puts the complexity of the progenote further back. And then, that complexity has to be explained. 

However, even these possess several hundred genes that encode the components of a fully fledged membrane; the replication, transcription, and translation machineries; a complex cell-division apparatus; and at least some central metabolic pathways. the simplest free-living cells are considerably more complex than this, with at least 1,300 genes. The only known autonomously replicating agents that are substantially simpler are viruses, but these are obligate intracellular parasites and do not present anything resembling an intermediate stage between a cell and a virus (whatever the direction of evolution might have been). So considering Omnis cellula e cellula and Omnis virus e virus, something has to give: The uniformitarian principle cannot apply to the origin of cells that must have evolved through a series of events that were fundamentally different from the familiar evolutionary processes. So here we discuss first the reconstruction of the gene repertoire of LUCA and then the implications of the results for the origin of cells.

The logic of change,
Koonin, page 213:
All known cells are complex and elaborately organized. The simplest known cellular life forms, the bacterial (and the only known archaeal) parasites and symbionts, clearly evolved by degradation of more complex organisms; however, even these possess several hundred genes that encode the components of a fully fledged membrane; the replication, transcription, and translation machineries; a complex cell-division apparatus; and at least some central metabolic pathways. The only known autonomously replicating agents that are substantially simpler are viruses, but these are obligate intracellular parasites and do not present anything resembling an intermediate stage between a cell and a virus (whatever the direction of evolution might have been). The uniformitarian principle cannot apply to the origin of cells that must have evolved through a series of events that were fundamentally different from the familiar evolutionary processes.







Barrier to bear life. 
Six barriers are shown in relation to the size of molecule. The largest barrier is No. 5 which is a transition from RNA world to DNA world. The last barrier is the birth of ecosystem. 8


 An arbitrary scale of complexity towards the emergence of life. 9





Bill Faint: life in any form is a very serious enigma and conundrum. It does something, whatever the biochemical pathway, machinery, enzymes etc. are involved, that should not and honestly could not ever "get off the ground". It SPONTANEOUSLY recruits Gibbs free energy from its environment so as to reduce its own entropy. That is tantamount to a rock continuously recruiting the wand to roll it up the hill, or a rusty nail "figuring out" how to spontaneously unrust and add layers of galvanizing zinc on itself to fight corrosion. Unintelligent simple chemicals can't self-organize into instructions for building solar farms (photosystems 1 and 2), hydroelectric dams (ATP synthase), propulsion (motor proteins) , self repair (p53 tumor suppressor proteins) or self-destruct (caspases) in the event that these instructions become too damaged by the way the universe USUALLY operates. Abiogenesis is not an issue that scientists simply need more time to figure out but a fundamental problem with materialism

Systems chemistry synthesis of building blocks. 
The evidence that certain chemistry was crucial to the emergence of life would be expected to be especially strong for C–C bond forming reactions and synthetic homologations or other elaborations based thereon. This is because early Earth carbon feedstocks were most likely one-carbon compounds, and yet most biomolecules have multiple contiguous carbon atoms. Joining two molecules of the same one-carbon compound together through C–C bond formation is difficult: electrophilic formaldehyde 1 does not easily dimerize, neither does the weaker electrophile carbon dioxide or the marginally nucleophilic carbon monoxide. By contrast, hydrogen cyanide 2 will dimerize through the attack of its nucleophilic conjugate base upon its weakly electrophilic self, but this reaction is sluggish, and the resultant dimer is more reactive than the monomer thus polymerization ensues.

Issues of directionality in the history of life are usually framed in terms of  major evolutionary steps, or megatrajectories (cf. Maynard Smith and Szathmary 1995): being the first steps

(1) evolution from the origin of life to the last common ancestor of extant organisms,
(2) the metabolic diversification of bacteria and archaea,
(3) evolution of eukaryotic cells







1. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2478661/
2. Koonin, The logic of chance, page 331
3. https://sci-hub.bz/https://www.nature.com/articles/s41570-016-0012?WT.feed_name=subjects_biosynthesis
4. Woese CR, Fox GE. 1977 The concept of cellular evolution. J. Mol. Evol. 10, 1 – 6. (doi:10.1007/ BF01796132) http://sci-hub.bz/https://link.springer.com/article/10.1007/BF01796132
5. http://www.pnas.org/content/95/12/6854.full
6. http://what-when-how.com/molecular-biology/progenote-molecular-biology/
7. http://www.els.net/WileyCDA/ElsArticle/refId-a0000463.html
8. http://www.sciencedirect.com/science/article/pii/S1674987112001272
9. https://libgen.pw/view.php?id=208133
10. https://www.ncbi.nlm.nih.gov/books/NBK232215/
11. http://www.pnas.org/content/95/12/6854.long
12. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322530/
13. https://arxiv.org/pdf/1705.08073.pdf



Last edited by Admin on Fri Dec 08, 2017 7:40 pm; edited 20 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
LUCA—The Last Universal Common Ancestor 1

The last universal common ancestor represents the primordial cellular organism from which diversified life was derived

http://reasonandscience.heavenforum.org/t2176-lucathe-last-universal-common-ancestor#3995


A minimal estimate for the gene content of the last universal common ancestor
19 December 2005
A fairly complex genome similar to those of free-living prokaryotes, with a variety of functional capabilities including metabolic transformation, information processing, membrane/transport proteins and complex regulation, shared between the three domains of life, emerges as the most likely progenitor of life on Earth, with profound repercussions for planetary exploration and exobiology. The estimate of LUCA's gene content appears to be substantially higher than that proposed previously, with a typical number of over 1000 gene families, of which more than 90% are also functionally characterized.a fairly complex genome similar to those of free-living prokaryotes, with a variety of functional capabilities including metabolic transformation, information processing, membrane/transport proteins and complex regulation, shared between the three domains of life, emerges as the most likely progenitor of life on Earth
http://sci-hub.bz/https://www.sciencedirect.com/science/article/pii/S0923250805002676

The Last Universal Common Ancestor: emergence, constitution and genetic legacy of an elusive forerunner
2008 Jul 9
LUCA does not appear to have been a simple, primitive, hyperthermophilic prokaryote but rather a complex community of protoeukaryotes with a RNA genome, adapted to a broad range of moderate temperatures, genetically redundant, morphologically and metabolically diverse.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2478661/

The proteomic complexity and rise of the primordial ancestor of diversified life
2011 May 25
Life was born complex and the LUCA displayed that heritage. Recent comparative genomic studies support the latter model and propose that the urancestor was similar to modern organisms in terms of gene content
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3123224/

Last Universal Common Ancestor had a complex cellular structure
OCT 5, 2011
New evidence suggests that LUCA was a sophisticated organism after all, with a complex structure recognizable as a cell, researchers report. Their study appears in the journal Biology Direct. The study lends support to a hypothesis that LUCA may have been more complex even than the simplest organisms alive today, said James Whitfield, a professor of entomology at Illinois and a co-author on the study.
http://news.illinois.edu/news/11/1005LUCA_ManfredoSeufferheld_JamesWhitfield_Caetano_Anolles.html

Cenancestor, the Last Universal Common Ancestor
02 September 2012
Theoretical estimates of the gene content of the Last Common Ansestor’s genome suggest that it was not a progenote or a protocell, but an entity similar to extant prokaryotes.
https://link.springer.com/article/10.1007/s12052-012-0444-8

Some Assembly Required: The Ingredients of Life
July 1, 2017
From analyses of bacterial microfossils, (some of which may be up to 3.48 billion years old) we know that the most primitive life was nearly as complex as today’s bacteria. Unfortunately, the (micro)fossil record can’t really tell us how we got from the simple chemicals to living, working, bacterial cells.
http://origins.case.edu/2017/07/01/some-assembly-required-the-ingredients-of-life/

Koonin, the logic of chance, page 213:
Comparative-genomic reconstruction of the gene repertoire of LUCA
Why do we believe that there was a LUCA? More than one argument supports the LUCA conjecture, but the strongest one seems to be the universal evolutionary conservation of the gene expression system. Indeed, all known cellular life forms use essentially the same genetic code (the same mapping of 64 codons to the set of 20 universal amino acids and the stop signal), with only a few minor deviations in highly degraded genomes of bacterial parasites and organelles. The universal conservation of the code and the expression machinery, and the most coherent evolutionary history of its components leave no reasonable doubt that this system is the heritage of some kind of LUCA.

The inference makes sense based on methodological naturalism. Once design is considered, one can infer common design of all life forms of the aforementioned machinery.

Arguments for a LUCA that would be indistinguishable from a modern prokaryotic cell have been presented, along with scenarios depicting LUCA as a much more primitive entity (Glansdorff, et al., 2008).
The difficulty of the problem cannot be overestimated. Indeed, all known cells are complex and elaborately organized. The simplest known cellular life forms, the bacterial (and the only known archaeal) parasites and symbionts, clearly evolved by degradation of more complex organisms; however, even these possess several hundred genes that encode the components of a fully fledged membrane; the replication, transcription, and translation machineries; a complex cell-division apparatus; and at least some central metabolic pathways. As we have already discussed, the simplest free-living cells are considerably more complex than this, with at least 1,300 genes. 

All the difficulties and uncertainties of evolutionary reconstructions notwithstanding, parsimony analysis combined with less formal efforts on the reconstruction of the deep past of particular functional systems leaves no serious doubts that LUCA already possessed at least several hundred genes. In addition to the aforementioned “golden 100” genes involved in expression, this diverse gene complement consists of numerous metabolic enzymes, including pathways of the central energy metabolism and the biosynthesis of amino acids, nucleotides, and some coenzymes, as well as some crucial membrane proteins, such as the subunits of the signal recognition particle (SRP) and the H+-ATPase.

However, the reconstructed gene repertoire of LUCA also has gaping holes. The two most shocking ones are

(i) the absence of the key components of the DNA replication machinery, namely the polymerases that are responsible for the initiation (primases) and elongation of DNA replication and for gap-filling after primer removal, and the principal DNA helicases, and
(ii) the absence of most enzymes of lipid biosynthesis. These essential proteins fail to make it into the reconstructed gene repertoire of LUCA because the respective processes in bacteria, on one hand, and archaea, on the other hand, are catalyzed by different, unrelated enzymes and, in the case of membrane phospholipids, yield chemically distinct membranes.

Thus, the reconstructed gene set of LUCA seems to be remarkably nonuniform, in that some functional systems appear to have reached complexity that is almost indistinguishable from that in modern organisms, whereas others come across as rudimentary or missing. This strange picture resembles the general concept of asynchronous “crystallization” of different cellular systems at the early stages of evolution that Carl Woese proposed and prompts one to step back and take a more general view of the LUCA problem.

These problems are solved, once someone takes another approach, and understands that a creator made each of the organisms distinctively and separately, each of its kind.

More specifically, with regard to membrane biogenesis, it has been proposed that LUCA had a mixed, heterochiral membrane, so that the two versions with opposite chiralities emerged as a result of subsequent specialization in archaea and bacteria, respectively. With regard to DNA replication, a hypothesis has been developed under which one of the modern replication systems is ancestral, whereas the other system evolved in viruses and subsequently displaced the original system in either the archaeal or the bacterial lineage. The other major area of nonhomology between archaea and bacteria, lipid biosynthesis (along with lipid chemistry), prompted the even more radical hypothesis of a noncellular although compartmentalized LUCA. Specifically, it has been proposed that LUCA(S) might have been a diverse population of expressed genetic elements that dwelled in networks of inorganic compartments.

This is a nice example of how there have to be far-fetched, invented, incredible, fictional made-up scenarios in order to keep the standard paradigm of philosophical naturalism.

The possibility that LUCA was dramatically different from any known cells has been brought up, originally in the concept of “progenote,” a hypothetical, primitive entity in which the link between the genotype and the phenotype was not yet firmly established. In its original form, the progenote idea involves primitive, imprecise translation, a notion that is not viable, given the extensive pre-LUCA diversification of proteins that the analysis of diverse protein superfamilies has demonstrated beyond doubt.

Even the most conservative models of the composition of LUCA paint it as a quite complex system, a true organism. A system like this would be very difficult to imagine arising directly from purely prebiotic chemical reactions.
ASTROBIOLOGY An Evolutionary Approach page 131


1) http://www.actionbioscience.org/evolution/poolepaper.html
2) http://www.ncbi.nlm.nih.gov/pubmed/16431085
3) http://www.macromol.uni-osnabrueck.de/paperMulk/Mulkid_Nat_Rev_Micro_2007.pdf
4) http://isites.harvard.edu/fs/docs/icb.topic635406.files/Becerra%20et%20al%202007.pdf
5) Koonin, the logic of chance, page 213



Last edited by Admin on Sun Dec 03, 2017 4:55 am; edited 5 times in total

View user profile http://elshamah.heavenforum.com

Admin


Admin
Essential elements and building blocks for the origin of life

Understanding the role of the Earth dynamics cannot be absent to construct the new plausible theory for origin of life. 6 The life is essentially composed of carbon, oxygen, hydrogen and nitrogen. Most living organisms postulate other inorganic elements to construct their bodies, to activate enzyme and for their metabolism. The series of inorganic elements demanded by living organisms are often called bio-essential elements. These include P, B, Mo, Mn, Cu and Zn among others.

At the core of life lies a network for the synthesis of the small organic molecules from which all biomass is derived. Remarkably, this core network of molecules and pathways is small (containing about 125 basic molecular building blocks) and very highly conserved. 2 If viewed at the ecosystem level – meaning that, for each compound, one asks what pathways must have been traversed in the course of its synthesis, disregarding which species may have performed the reaction or what trophic exchanges may have befallen pathway intermediates along the way – the core network is also essentially universal.

The primitive prebiotic environment contained a broad array of organic compounds, only a few of which would have been useful to the origin of nucleic acids. What sort of  processes leading to nucleic acids can be imagined in such an environment? If a useful step in chemical evolution were achieved, how would it become stabilized so that it would be an integral part of the developing system? There are no sure answers to such questions. 3

The overall metabolism is based on seven non-metal elements, H, C, N, 0, P, S and Se. With these elements, all the major polymers of all cells are made. Hence the major metabolic pathways involve them. Their uptake and loss are the major flows of material. Most of this metabolism in the cytoplasm is unchanged in all cells to this day 4



Our present atmosphere consists of 78% nitrogen (N2), 21% molecular oxygen (O2), and 1% of other gases, such as carbon dioxide CO2), argon (Ar), and water vapor H2O). An atmosphere containing free oxygen would be fatal to all origin of life schemes. While oxygen is necessary for life, free oxygen would oxidize and thus destroy all organic molecules required for the origin of life. Thus, in spite of much evidence that the earth has always had a significant quantity of free oxygen in the atmosphere, 3 proponents of evolution  persist in declaring that there was no oxygen in the earth's early atmosphere. However, this would also be fatal to an evolutionary origin of life. If there were no oxygen there would be no protective layer of ozone surrounding the earth. Ozone is produced by radiation from the sun on the oxygen in the atmosphere, converting the diatomic oxygen(O2) we breathe to triatomic oxygen O3), which is ozone. Thus if there were no oxygen there would be no ozone. The deadly destructive ultraviolet light from the sun would pour down on the surface of the earth unimpeded, destroying those organic molecules required for life, reducing them to simple gases, such as nitrogen, carbon dioxide, and water. Thus, proponents of evolution face an irresolvable dilemma: in the presence of oxygen, life could not evolve; without oxygen, thus no ozone, life could not evolve or exist. 1

Carbon
Carbon is unique in its ability to combine with other atoms, forming a vast and unparalleled number of compounds in combination with hydrogen, oxygen and nitrogen. This universe of organic chemistry— with its huge diversity of chemical and physical properties—is precisely what is needed for the assembling of complex chemical systems. Furthermore, the general ‘metastability’ of carbon bonds and the consequent relative ease with which they can be assembled and rearranged by living systems  contributes greatly to the fitness of carbon chemistry for biochemical life. No other atom is nearly as fit as carbon for the formation of complex biochemistry. Today, one century later, no one doubts these claims. Indeed the peerless fitness of the carbon atom to build chemical complexity and to partake in biochemistry has been affirmed by a host of researchers.

One widely publicized coincidence is the ‘lucky’ fact that the nuclear resonances of the isotopes 12C and 16O are exactly what they need to be if carbon is to be synthesized and accumulate in any quantity in the interior of stars . The energy levels of these resonances ensure that 12C is first synthesized in stellar interiors from collisions between 8Be (beryllium) and He (helium) nuclei, and that the carbon synthesized is not depleted later. Hoyle made this discovery in 1953 while working at Caltech with William Fowler. An intriguing aspect of the discovery is that Hoyle made it based on a prediction from the anthropic principle . Hoyle himself
famously commented:

If you wanted to produce carbon and oxygen in roughly equal quantities by stellar nucleosynthesis, these are the two levels you would have to fix, and your fixing would have to be just about where these levels are found to be ... A common sense interpretation of the facts suggests that a super intellect has monkeyed with physics, as well as chemistry and biology, and that there are no blind forces worth speaking about in nature.

This discovery was acclaimed not only as a major scientific discovery but also as further evidence of the biocentricity of nature. Hoyle may have been one of the first to notice that the conditions necessary to permit carbon-based life require a very narrow range of basic physical constants, but the idea is now widely accepted. If those constants had been very slightly different, the universe would not have been conducive to the development of matter, astronomical structures, or elemental diversity, and thus the emergence of complex chemical systems.

Chlorine
This is a fascinating element that is found in all living tissue.  Chlorine is essential for the function of cleansing the body of debris.  It is also exchanged in the stomach to produce hydrochloric acid, a very necessary acid for protein digestion. Chlorine is a member of a group of elements called the halogens.  Others in this group are fluoride, iodine, and bromine.  The body maintains a delicate balance between all these elements. Today too much chlorine, bromine and fluoride are overwhelming the iodine and causing deficiencies in our bodies. Deficiency of this element is non-existent, unlike all the other electrolytes.  The reason is that chlorine is part of salt (NaCl).  Most people eat too much, rather than too little table salt, as it is found in almost all prepared and processed food items today.  Thus we do not focus on this element in terms of deficiencies. In contrast, excessive exposure to chlorine is a severe problem.  Too much table salt and chlorinated water are the main sources.  Some bleached flour products are also sources.  Environmental contamination of the food, water, and air are constant sources of this element, which is highly toxic in these forms. 3

Hydrogen
The most abundant element in the universe, hydrogen is also a promising source of "clean" fuel on Earth. Named after the Greek words hydro for "water" and genes for "forming," hydrogen makes up more than 90 percent of all of the atoms, which equals three-quarters of the mass of the universe, according to the Los Alamos National Laboratory. Hydrogen is essential for life, and it is present in nearly all the molecules in living things, according to the Royal Society of Chemistry. The element also occurs in the stars and powers the universe through the proton-proton reaction and carbon-nitrogen cycle. 4

Nitrogen
As nitrogen is a biochemically essential element, sources of biochemically accessible nitrogen, especially reduced nitrogen, are critical to prebiotic chemistry and the origin of life. 5
Nitrogen is the fourth most abundant element in cellular biomass, and it comprises the majority of Earth’s atmosphere. 15  The interchange between inert dinitrogen gas (N2 ) in the extant atmosphere and ‘reactive nitrogen’ (those nitrogen compounds that support, or are products of, cellular metabolism and growth) is entirely controlled by microbial activities. 

This was not the case, however, in the primordial atmosphere, when abiotic reactions were the only possible players in the inter-transformation of nitrogen oxides. The extant nitrogen cycle is driven by reductive fixation of dinitrogen and an enzyme inventory that facilitates dinitrogen-producing reactions.

Nitrogen is an essential nutrient for all life on Earth and it acts as a major control on biological productivity in the modern ocean. 14  It forms versatile covalent bonds with carbon that are integral to the functioning of organic biomolecules. A better understanding of the origin of life on Earth, therefore, demands a reconstruction of the biogeochemical nitrogen cycle.  The partial pressure of nitrogen gas (N2) in the atmosphere controls the degree of pressure-broadening of greenhouse gas adsorption and thus surface temperature.  Some nitrogenous gaseous species are powerful greenhouse gases themselves, such as nitrous oxide (N2O) and nitrogen dioxide (NO2)  These gases can also affect climate indirectly by their role in the formation of ozone (O3), which is a powerful greenhouse agent in the troposphere. 

Oxygen of Earth‟s atmosphere and oceans plays a major role in the global biogeochemical nitrogen cycle. 

Loss of atmospheric nitrogen can result in loss of the ability to sustain liquid water on a planetary surface, which would impact planetary habitability and hydrological processes that shape the surface. 12   Nitrogen is a critical ingredient of complex biological molecules 11 The stellar energy fluxes had to be high enough to ignite reactive chemistry that produces complex molecules crucial for life. As a byproduct, this chemistry forms greenhouse gases that can efficiently keep the atmosphere warm enough for liquid water to exist. Molecular nitrogen, however, which was outgassed into the Earth’s early atmosphere, is relatively chemically inert and nitrogen fixation into more chemically reactive compounds requires high temperatures. Possible mechanisms of nitrogen fixation include lightning, atmospheric shock heating by meteorites, and solar ultraviolet radiation.

Nitrogen is one of the essential nutrients of life on Earth, with some organisms, such as the kinds of microbes found within the roots of legume plants, capable of converting nitrogen gas into molecules that other species can use. Nitrogen fixation, as the process is called, involves breaking the powerful chemical bonds that hold nitrogen atoms in pairs in the atmosphere and using the resulting single nitrogen atoms to help create molecules such as ammonia, which is a building block of many complex organic molecules, such as proteins, DNA and RNA. Stüeken developed a model of abiotic nitrogen processes that could have played a role in early Earth. The results showed that such abiotic processes alone could not explain the nitrogen levels seen in the Isua rocks. 

Terrestrial nitrogen isotopic compositions are distinct from solar and cometary values and similar to those of primitive meteorites, so its speculated  that Earth’s atmospheric nitrogen originates from a primordial cosmochemical source. Prebiotic organic compounds containing nitrogen that formed in the solar protoplanetary disk, such as amino acids, would have contributed to the emergence of life on Earth.

Another paper suggested an unusual mechanism to fix nitrogen in the early Earth by lightning discharges occurring inside explosive volcanic clouds containing gases characteristic of Hawaiian volcanoes as a model of Archean volcanic volatiles. 13

Potassium
Potassium is an essential mineral micronutrient and is the main intracellular ion for all types of cells. It is important in maintaining fluid and electrolyte balance in the bodies of humans and animals. Potassium is necessary for the function of all living cells and is thus present in all plant and animal tissues. It is found in especially high concentrations within plant cells, and in a mixed diet, it is most highly concentrated in fruits. The high concentration of potassium in plants, associated with comparatively very low amounts of sodium there, historically resulted in potassium first being isolated from the ashes of plants (potash), which in turn gave the element its modern name. The high concentration of potassium in plants means that heavy crop production rapidly depletes soils of potassium, and agricultural fertilizers consume 93% of the potassium chemical production of the modern world economy.

Potassium, another solvent mineral, and a heart mineral.  It is also essential for regulation of the heartbeat, fluid balance and to maintain blood pressure.  It is also needed for buffering the blood, and cell membrane effects including nerve transmission and muscular contraction.  Deficiency can cause cramps, fatigue and heart irregularities.  Good sources are herring, sardines, halibut, goose, most nuts and seeds, watercress, garlic, lentils, spinach, artichokes, lima beans, Swiss chard, avocados, buckwheat, wheat bran, molasses, and kelp.  Be sure to drink the water in which you cook vegetables to obtain the potassium from the vegetables. [url=http://drlwilson.com/articles/minerals for life.htm]6[/url] 

Calcium
In view of the importance of calcium (Ca2+) as a universal intracellular regulator, its essential role in cell signaling and communication in many biological Intra and extracellular processes,  it is surprising how little it is mentioned in the origins ( evolution/ID) debate. Most discussions about the origin of life start with RNA worlds versus metabolism-first scenarios, panspermia, hydrothermal vent theory etc. The origin of life cannot be elucidated, without taking into consideration and explaining how the calcium signaling machinery and cell homeostasis appeared. 

Calcium, the structural element, is found mainly in our bones.  Calcium also regulates cell membrane permeability to control nerve impulse transmission and muscle contraction.  It is important for blood clotting, and it regulates hormonal secretion and cell division. Good food sources are dairy products such as cheese and yogurt.  Smaller amounts are in milk, sardines, egg yolks, almonds, sesame seeds, seaweed and dark green vegetables.  Goat cheese is better than cow’s milk cheese for most people because cows are often fed or injected with antibiotics, female hormones, and growth hormones. 6

Molybdenum 
Minerals containing the elements boron and molybdenum are key in assembling atoms into life-forming molecules. 11 The researcher points out that boron minerals help carbohydrate rings to form from pre-biotic chemicals, and then molybdenum takes that intermediate molecule and rearranges it to form ribose, and hence RNA. This raises problems for how life began on Earth, since the early Earth is thought to have been unsuitable for the formation of the necessary boron and molybdenum minerals. It is thought that the boron minerals needed to form RNA from pre-biotic soups were not available on early Earth in sufficient quantity, and the molybdenum minerals were not available in the correct chemical form. "It’s only when molybdenum becomes highly oxidised that it is able to influence how early life formed. "This form of molybdenum couldn’t have been available on Earth at the time life first began, because three billion years ago, the surface of the Earth had very little oxygen. 7

Sulfur
Sulfur, a fiery cleansing and joining mineral.  It is an important element for digestion and detoxification in the liver.  It is needed for the joints and in all connective tissue.  This includes the hair, skin and nails.  Most dietary sulfur comes from sulfur-containing amino acids found mainly in animal protein foods.  Good sources are eggs, meats, and often smelly foods like garlic and onions.  Other sources are kale, watercress, Brussels sprouts, horseradish, cabbage cauliflower, and cranberries. Vegetarians can easily become deficient in sulfur if they do not eat eggs.  Deficiency can affect hair, nails, skin, joints, energy and the ability to detoxify poisons. Today, plenty of organic or usable sulfur is needed to oppose excess copper in the body.  Most people today have too much biounavailable copper in their bodies, and sulfur is needed to help remove it.  Good sources are animal proteins such as eggs, particularly the egg yolk.  [url=http://drlwilson.com/articles/minerals for life.htm]6[/url]

Iron
The origin of life required two processes that dominated: 
(1) the generation of a proton gradient and
(2) linking this gradient to ATP production in part and in part to uptake of essential chemicals and rejection of others. The generation of a proton gradient required especially appropriate amounts of iron (Fe2+), levels for electron transfer and the ATP production depended on controlling H+, Mg2+ and phosphate in the cytoplasm. 8

Iron serves essential functions in both prokaryotes and eukaryotes, and cells have highly specialized mechanisms for acquiring and handling this metal. 
Organisms use a variety of transition metals as catalytic centers in proteins, including iron, copper, manganese, and zinc. Iron is well suited to redox reactions due to its capability to act as both an electron donor and acceptor. In eukaryotic cells, iron is a cofactor for a wide variety of metalloproteins involved in energy metabolism, oxygen binding, DNA biosynthesis and repair, synthesis of biopolymers, cofactors, and vitamins, drug metabolism, antioxidant function, and many others. Because iron is so important for survival, organisms utilize several techniques to optimize uptake and storage to ensure maintenance of sufficient levels for cellular requirements. However, the redox properties of iron also make it extremely toxic if cells have excessive amounts. Free iron can catalyze the formation of reactive oxygen species such as the hydroxyl radical, which in turn can damage proteins, lipids, membranes, and DNA. Cells must maintain a delicate balance between iron deficiency and iron overload that involves coordinated control at the transcriptional, post-transcriptional, and post-translational levels to help fine tune iron utilization and
iron trafficking.  

Iron, the oxygen carrier and an energy mineral as well.  It is required in hemoglobin for transporting oxygen in the blood, for detoxification and for energy production in the cells.  Iron is found in lean meats, organ meats, shellfish, molasses, beans, whole-grain cereals, and dark green vegetables.  Menstruating women and children on poor diets are most commonly low in iron.  For much more information about iron, read Chronic Iron Toxicity.

Magnesium
There are 24  metal and nonmetal elements, that are essential for life, amongst them magnesium, which plays a critical role in cellular metabolism,  DNA repair, its also present in all deoxyribonucleic acid (DNA) and RNA activation processes, stabilizing macromolecular complexes and membranes. As activator of over 300 different enzymes, magnesium participates in many metabolic processes, such as glycolysis, Krebs cycle, β-oxidation or ion transport across cell membranes. Cells must have mechanisms to maintain physiological levels of Mg2+. It is indispensable for the nucleus ( in eukaryotes ) to function as a whole and for the maintenance of physical stability as well as aggregation of rybosomes into polysomes able to initiate protein synthesis. All these different essential roles elucidate that life could not have had a first go without magnesium.

But in order for the cell to be able to make use of it, Magnesium like other metal ions has to be transported inside cells across the cell membrane by specific membrane proteins.  Three distinct classes of Mg2+ transporters have been identified in bacteria. MgtA transporter proteins can sense magnesium ions down to micromolar concentrations, which is the equivalent to a pinch (1 gram) of magnesium salt in 10,000 liters of water. Wow ! This detection system depends on a specific lipid molecule in the membrane called cardiolipin. MgtA and cardiolipin have to work together in an interdependent manner.

Organisms must maintain physiological levels of Mg2+ because this divalent cation is critical for the stabilization of membranes and ribosomes, the neutralization of nucleic acids, and as a cofactor in a variety of enzymatic reactions. Furthermore, specialized biosynthesis pathways and specialized proteins exist to make these import proteins and cardiolipin.

Magnesium is the bright and shining mineral. Magnesium is named after the Greek city of Magnesia, where large deposits of magnesium carbonate were found centuries ago.  It is required for over 500 enzymes that regulate sugar metabolism, energy production, cell membrane permeability, and muscle and nerve conduction. Foods high in magnesium include milk, almonds, brazil nuts, cashews, whole soybeans (but not tofu, tempeh or soy protein), parsnips, wheat bran, whole grains, green vegetables, seafood, kelp and molasses. Most people need more magnesium than they are eating because food refining strips away magnesium.  Deficiency causes muscle cramps, weakness, depression, and fatigue.  Magnesium works closely with potassium and is a calcium antagonist. 9

Magnesium and magnesium transporters, another example of cell interdependence comes to light
http://reasonandscience.heavenforum.org/t2440-magnesium-and-magnesium-transporters-another-example-of-interdependence-comes-to-light

Phosphate
The short supply of phosphorus poses a significant problem for a naturalistic origin of life because so much of this ingredient is required to make replicator molecules. Phosphates are part of the backbone of both DNA and RNA. A phosphate molecule must accompany every nucleoside in them. Possible precursors to DNA and RNA molecules would seem to require similar phosphate richness. Without life molecules (already assembled and operating), no known natural process can harvest the amounts of phosphorus necessary for life from the environment. All the phosphate-rich deposits on Earth are produced by life.

Phosphorus, the fiercest energy mineral.  It is required for energy production, DNA synthesis, and protein synthesis.  It is also needed for calcium metabolism, muscle contraction, and cell membrane structure. Excellent sources include all meats, along with eggs, fish and other animal proteins.  All proteins have some phosphorus in them.  However, red meats and high purine proteins tend to have the most.  These include organ meats, sardines, and anchovies.  The latter two are not bad fish to eat.  Other fish tend to be too high in mercury to make them good foods for regular use.  Other decent food sources are most nuts and seeds, chickpeas, garlic, lentils, popcorn, soybeans, and some cheeses. Animal-based sources of phosphorus are often absorbed better than grains and beans that contain phytates.  These are phosphorus compounds that are not well-absorbed and that actually interfere with the absorption of calcium, magnesium, and zinc, in particular.  They are found in most grains and beans.  This is why proper cooking and preparation of bread, beans, and other foods is extremely important.  Eating these foods raw eating unleavened bread is not wise for this reason.

Sodium
the volatility and the solvent mineral.  It helps regulate blood pressure, fluid balance, transport of carbon dioxide, and affects cell membrane permeability and other cell membrane functions.  Deficiency causes fatigue and fluid imbalances such as low blood pressure. Food sources include sea salt, seafood, eggs, beet greens, Swiss chard, olives, peas, and butter.  Table salt is a refined junk food.  Most of the minerals have been stripped away, and aluminum is often added as a flowing agent.  Use natural sea salt instead. 

Zinc
It is vital for the functionality of more than 300 enzymes, for the stabilization of DNA, and for gene expression. Helps generate cells Important for growth and brain development Key for immune system Humans need up to 15 mg of zinc per day. Zinc Deficiency is 5th Leading Cause of Death and Disease in the Developing World

Zinc is required for hundreds of enzymes in the human body.  These include the sense of taste and smell, vision, growth, sexual development, digestive enzyme production, male potency, prostate gland health, blood sugar regulation and processing of alcohol.Zinc is very important for the joints, the skin, wound healing, and to prevent birth defects.  Zinc helps prevent diabetes, acne, epilepsy and childhood hyperactivity, and helps detoxify heavy metals.  Adequate zinc has a calming effect and is needed to regenerate all body tissues.Refined food is very low in zinc.   There are very few excellent sources of zinc today.  Among the best are red meats, organ meats and some seafood.  Other sources that are not quite as good are poultry such as chicken and turkey, eggs, wheat, oatmeal, pumpkin and sunflower seeds, wheat germ and colostrum.  
Vegetarians run a high risk of zinc deficiency because they avoid red meats, in most cases.  Low zinc, especially in vegetarians, tends to cause a worsening of copper toxicity.  

Chromium 
a blood sugar mineral .  It is also an energy mineral.  A desert rodent called the sand rat develops diabetes when fed a laboratory diet.  When returned to the desert, the diabetes goes away.  Extensive research indicates the problem with the laboratory food is a lack of chromium.
Chromium is essential to for insulin metabolism.  It can also help lower cholesterol.  Chromium deficiency is very common, especially in middle-aged and older people. Food sources of chromium are brewers yeast, liver, kidney, beef, whole wheat bread, wheat germ, beets, mushrooms and beer. Unfortunately, most of these foods are not recommended for various reasons.  Chromium can be obtained from supplements, and this is usually the best way to make sure you get enough each day.
 
Selenium
 is required for the development of certain higher brain centers.  Selenium is vital for detoxification and for thyroid activity in the human body, among its many functions.  It is also needed for protein synthesis, helps the body get rid of toxic cadmium and mercury, and is needed for antioxidant production (glutathione peroxidase).  As an anti-oxidant, it may help prevent cancer and birth defects.  
 
Lithium
It is also a more advanced spiritual mineral for the future.  It has a calming, balancing and protective effect on the brain and the entire nervous system.  It is found in many natural foods so it is not necessary to supplement it in many cases.  However, anyone who is taking an anti-depressant or any brain-altering drug, or is suffering from any brain-related problem may benefit from a natural lithium supplement such as lithium orotate.  The lithium used by medical doctors for bipolar disorder is quite toxic and should be avoided if at all possible.  The natural product is far less potent, but is better absorbed and much less toxic or perhaps totally non-toxic. 


Cobalt
vitamin B12 mineral.  Cobalt is essential for life as part of the vitamin B12 molecule.  Vitamin B12 is required for the nervous system and blood formation.  It is found in animal products.  Deficiency causes anemia and a very severe dementia that can be irreversible.
Deficiency occurs mainly in strict vegetarians and in those with impaired digestion or any disorder of the stomach.  It is deficient in some elderly people whose stomach does not absorb it very well.

Iodine 
a cleanser and a thyroid mineral (along with manganese).  Iodine, however, it is required for all the cells of the body.  It is somewhat more important for women.  It is needed to make thyroid hormones, and for the regulation of metabolism.  It is important for women’s breast health, cancer prevention and many other body functions in somewhat mysterious ways. 

Boron  
It is very essential for plants, though perhaps less so for human beings.  Boron can help maintain female hormone production and bone integrity. 
 
Silicon
along with selenium, is important for the bones and skin.  Food sources include lettuce, parsnips, asparagus, dandelion greens, rice bran, horseradish, onion, spinach and cucumbers, and in herbs such as horsetail.  Since it is in many foods, supplements are usually not needed.  Silicon and selenium also are both spiritual minerals needed for higher brain activity.
 
Trace minerals often work in pairs or triplets.  The interaction of minerals in the body is a complex and interesting subject.  There are many other trace minerals such as molybdenum, vanadium, bromine, germanium, nickel, tin, cesium, rubidium, strontium, gold, silver, titanium, tritium and others. 10

Essential Molecules for life
Molecules are lifeless. Yet, the properties of living things derive from the properties of molecules. Molecules are lifeless. Yet, in appropriate complexity and number, molecules compose living things. These living systems are distinct from the inanimate world because they have certain extraordinary properties. They can grow, move, perform the incredible chemistry of metabolism, respond to stimuli from the environment, and, most significantly, replicate themselves with exceptional fidelity. The complex structure and behavior of living organisms veil the basic truth that their molecular constitution can be described and understood. The chemistry of the living cell resembles the chemistry of organic reactions. Indeed, cellular constituents, or biomolecules, must conform to the chemical and physical principles that govern all matter. Despite the spectacular diversity of life, the intricacy of biological structures, and the complexity of vital mechanisms, life functions are ultimately interpretable in chemical terms. Chemistry is the logic of biological phenomena. Living organisms are selfsustaining systems of chemical reactions. The most obvious quality of living organisms is that they are complicated and highly organized. Macromolecules themselves show an exquisite degree of organization in their intricate three-dimensional architecture, even though they are composed of simple sets of chemical building blocks, such as sugars and amino acids. Indeed, the complex three-dimensional structure of a macromolecule, known as its conformation, is a consequence of interactions between the monomeric units, according to their individual chemical properties. In biology, it is always meaningful to seek the purpose of observed structures, organizations, or patterns; that is, to ask what functional role they serve within the organism. Maintenance of the highly organized structure and activity of living systems depends on their ability to extract energy from the environment. The ultimate source of energy is the sun. Solar energy flows from photosynthetic organisms (organisms able to capture light energy by the process of photosynthesis) through food chains to herbivores and ultimately to carnivorous predators at the apex of the food pyramid. Living systems have a remarkable capacity for self-replication. Generation after generation, organisms reproduce virtually identical copies of themselves. This selfreplication can proceed by a variety of mechanisms, ranging from simple division in bacteria to sexual reproduction in plants and animals; but in every case, it is characterized by an astounding degree of fidelity.

Cells are biochemical entities that synthesize many thousands of molecules. Studying these chemicals and the biochemistry of the cell would be extremely difficult were it not for the fact that most of the chemical variation is based on six types of molecules that are assembled into just five types of macromolecules. The six basic molecules are

amino acids,
phosphate,
glycerol,
sugars,
fatty acids,
and nucleotides.


            
The stuff of life
• proteins (amino acids)
• lipids (alcohols & fatty acids)
• carbohydrates (sugars)
• nucleic acids (nucleotides)
• small molecules (water, metals, ions, etc.)

all are polymers formed by condensation reactions

Proteins
Proteins are a diverse and abundant class of biomolecules, constituting more than 50% of the dry weight of cells. Their diversity and abundance reflect the central role of proteins in virtually all aspects of cell structure and function. An extraordinary diversity of cellular activity is possible only because of the versatility inherent in proteins, each of which is specifically tailored to its biological role. The pattern by which each is tailored resides within the genetic information of cells, encoded in a specific sequence of nucleotide bases in DNA. Each such segment of encoded information defines a gene, and expression of the gene leads to synthesis of the specific protein encoded by it, endowing the cell with the functions unique to that particular protein. Proteins are the agents of biological function; they are also the expressions of genetic information.

Proteins play critical roles in nearly all life processes. The word protein comes from the Greek proteios (meaning of the first rank), which aptly describes their importance. Proteins account for about 50% of the organic material in a typical animal’s body.



Carbohydrates
Carbohydrates are the single most abundant class of organic molecules found in nature. Energy from the sun captured by green plants, algae, and some bacteria during photosynthesis  converts more than 250 billion kilograms of
carbon dioxide into carbohydrates every day on earth. In turn, carbohydrates are the metabolic precursors of virtually all other biomolecules. Breakdown of carbohydrates provides the energy that sustains animal life. In addition, carbohydrates are covalently linked with a variety of other molecules. These glycoconjugates are important components of cell walls and extracellular structures in plants, animals, and bacteria. In addition to the structural roles such molecules play, they serve in a variety of processes involving recognition between cell types or recognition of cellular structures by other molecules. Recognition events are important in normal cell growth, fertilization, transformation of cells, and other processes. All of these functions are made possible by the characteristic chemical features of carbohydrates. 

Carbohydrates are composed of carbon, hydrogen, and oxygen atoms in or close to the proportions represented by the general formula Cn(H2O)n, where n is a whole number. This formula gives carbohydrates their name—carbon-containing compounds that are hydrated, that is, contain water. Most of the carbon atoms in a carbohydrate are linked to a hydrogen atom and a hydroxyl functional group. However, other functional groups, such as amino and carboxyl groups, are also found in certain carbohydrates. Sugars are relatively small carbohydrates, whereas polysaccharides are large macromolecules.



Lipids
Lipids are a class of biological molecules defined by low solubility in water and high solubility in nonpolar solvents. As molecules that are largely hydrocarbon in nature, lipids represent highly reduced forms of carbon and, upon oxidation in metabolism, yield large amounts of energy. Lipids are thus the molecules of choice for metabolic energy storage. Lipid molecules are key components of membranes and also serve a myriad of roles as signal molecules in biological systems. Lipids are integrators of cellular function and intercellular communication. Lipid–lipid and lipid–protein interactions regulate cellular physiology.

Lipids are hydrophobic molecules composed mainly of hydrogen and carbon atoms, and some oxygen. The defining feature of lipids is that they are nonpolar and therefore insoluble in water. Lipids account for about 40% of the organic matter in the average human body and include fats, phospholipids, steroids, and waxes.

Nucleic Acids
Nucleotides and nucleic acids are substances that contain nitrogen bases (aromatic cyclic groups possessing nitrogen atoms) as part of their structure. Nucleotides are essential to cellular metabolism, and nucleic acids are the molecules of genetic information storage and expression. Nucleotides are biological molecules that possess a heterocyclic nitrogenous base, a five-carbon sugar (pentose), and phosphate as principal components of their structure. The biochemical roles of nucleotides are numerous; they participate as essential intermediates in virtually all aspects of cellular metabolism. Serving an even more central biological purpose are the nucleic acids, the elements of heredity and the agents of genetic information transfer. Just as proteins are linear polymers of amino acids, nucleic acids are linear polymers of nucleotides. Like the letters in this sentence, the orderly sequence of nucleotide residues in a nucleic acid can encode information. The two basic kinds of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The five-carbon sugar in DNA is 2-deoxyribose; in RNA, it is ribose.  DNA is the repository of genetic information in cells, whereas RNA serves in the expression of this information through the processes of transcription and translation. An interesting exception to this rule is that some viruses have their genetic information stored as RNA. This chapter describes the chemistry of nucleotides and the major classes of nucleic acids.

Nucleic acids account for only about 2% of the weight of animals like humans, yet these molecules are extremely important because they are responsible for the storage, expression, and transmission of genetic information. The expression of genetic information in the form of specific proteins determines whether an organism is a human, a frog, an onion, or a bacterium.

Nucleotides Are the Building Blocks of DNA and RNA
The two classes of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecules store genetic information coded in the sequence of their building blocks. RNA molecules are involved in decoding this information into instructions for linking a specific sequence of amino acids to form a polypeptide. The monomers in DNA must be arranged in a precise way so that the correct code can be read. Like other macromolecules, DNA and RNA are polymers consisting of linear sequences of repeating monomers.  Each monomer, known as a nucleotide, has three components: 

(1) a phosphate group, 
(2) a pentose (five-carbon) sugar (either ribose or deoxyribose), and 
(3) a single or a double ring of carbon and nitrogen atoms known as a base



Water
Water is a major chemical component of the earth’s surface. It is indispensable to life. Indeed, it is the only liquid that most organisms ever encounter. We are prone to take it for granted because of its ubiquity and bland nature, yet we marvel at its many unusual and fascinating properties. At the center of this fascination is the role of water as the medium of life. Organisms are not independent from water. Typically, organisms are 70% to 90% water. Indeed, normal metabolic activity can occur only when cells are at least 65% H2O. This dependency of life on water is not a simple matter, but it can be grasped by considering the unusual chemical and physical properties of H2O. Water and its ionization products, hydrogen ions and hydroxide ions, are critical determinants of the structure and function of many biomolecules, including amino acids and proteins, nucleotides and nucleic acids, and even phospholipids and membranes. In yet another essential role, water is an indirect participant—a difference in the concentration of hydrogen ions on opposite sides of a membrane represents an energized condition essential to biological mechanisms of energy transformation. 


The problems of the origin/source of the elements
1. The origin/source of the elements
2. The origin/source of small molecule precursors
3. The origin/source of monomers
4. The condensation problem
5. The self-replication problem
6. The chirality problem
7. The compartmentalization problem

Elements of life
• nucleic acids (CHOPN)
• proteins (CHOSN)
• lipids (CHO)
• polysaccharides (CHO)
• catalysts (Fe, Mg, Ca, Mn, Ni, Zn, Cu, Se, Co, Mo)
• counterions (Na, K, F, Cl, Br, I)
• neutrals, for clays (Al, Si)

in total, about 22–24 elements:
H, C, N, O, F, Na, Mg, Al, Si, P, S, Cl, K, Ca, Mn, Fe, Co, Ni, Cu, Zn, Se, Br, Mo, I

The five macromolecules are

proteins,
DNA,
RNA,
phospholipids,  
sugar polymers called polysaccharides.

The six basic molecules are used by all cells to construct five essential macromolecules: proteins, RNA, DNA, phospholipids, and polysaccharides. Macromolecules have primary, secondary, and tertiary structural levels. The primary structural level refers to the chain that is formed by linking the building blocks together. The secondary structure involves the bending of the linear chain to form a three-dimensional object. Tertiary structural elements involve the formation of chemical bonds between some of the building blocks in the chain to stabilize the secondary structure. A quaternary structure can also occur when two identical molecules interact to form a dimer or double molecule. Proteins are long chains or polymers of amino acids. The primary structure is held together by peptide bonds that link the carboxyl end of one amino acid to the amino end of a second amino acid. Thus, once constructed, every protein has an amino end and a carboxyl end. An average protein consists of about 400 amino acids.

There are 21 naturally occurring amino acids; with this number, the cell can produce an almost infinite variety of proteins. Eukaryote cells function well with 10,000 to 30,000 different proteins. In addition, this select group of proteins has been conserved (i.e., most of the proteins found in yeast can also be found, in modified form, in humans and other higher organisms). The secondary structure of a protein depends on the amino acid sequence and can be quite complicated, often producing three-dimensional structures possessing multiple functions. RNA is a polymer of the ribonucleotides adenine, uracil, cytosine, and guanine. RNA is generally single-stranded, but it can form localized double-stranded regions by a process known as the complementary base pairing, whereby adenine forms a bond with uracil and cytosine pairs with guanine. RNA is involved in the synthesis of proteins and is a structural and enzymatic component of ribosomes. 5

1. http://www.icr.org/article/few-reasons-evolutionary-origin-life-impossible/
2. http://thisquantumworld.com/wp/a-critique-of-quantum-mechanics/fine-tuning/
3. http://www.warriormatrix.com/about13509.html&sid=0a2ba2e8e17096632a536b1d8d85f852
4. https://www.livescience.com/28466-hydrogen.html
5. https://www.astrobio.net/news-exclusive/nitrogen-ancient-rocks-sign-early-life/
6. http://drlwilson.com/articles/minerals%20for%20life.htm
7. http://www.universityherald.com/articles/4375/20130829/earth-life-began-mars-red-planet-building-blocks-rna-dna.htm
8. https://link.springer.com/chapter/10.1007/978-3-642-58306-3_1
9. http://www.living-well.info/minerals-for-life/
10. http://drlwilson.com/Articles/MINERALS%20FOR%20LIFE.htm
11. http://sci-hub.bz/https://www.nature.com/articles/ngeo2719
12. http://sci-hub.bz/http://online.liebertpub.com/doi/abs/10.1089/ast.2011.0646?journalCode=ast
13. http://onlinelibrary.wiley.com/doi/10.1029/98GL02423/pdf
14. http://sci-hub.bz/https://www.sciencedirect.com/science/article/pii/S0012825216301829
15. http://www.cell.com/current-biology/pdf/S0960-9822(15)01518-3.pdf



Last edited by Admin on Fri Dec 08, 2017 9:12 pm; edited 9 times in total

View user profile http://elshamah.heavenforum.com

8 From DNA to Proteins on Sun Dec 03, 2017 5:27 am

Admin


Admin
From DNA to Proteins
Since the structure of DNA was discovered in the early 1950s, progress in cell and molecular biology has been astounding. 1 We now know the complete genome sequences for thousands of different organisms, revealing fascinating details of their biochemistry as well as important clues of adaptation.  Knowing the maximum amount of information that is required to produce a complex organism like ourselves puts constraints on the biochemical and structural features of cells and makes it clear that biology is not infinitely complex. The DNA in genomes does not direct protein synthesis itself, but instead uses RNA as an intermediary. When the cell needs a particular protein, the nucleotide sequence of the appropriate portion of the immensely long DNA molecule in a chromosome is first copied into RNA (a process called transcription). It is these RNA copies of segments of the DNA that are used directly as templates to direct the synthesis of the protein (a process called translation). The flow of genetic information in cells is therefore from DNA to RNA to protein


The central dogma of genetics.
The usual flow of genetic information is from DNA to mRNA to polypeptide. Note: The direction of informational flow shown in this figure is the most common direction found in living organisms, but exceptions occur. For example, RNA viruses and certain transposable elements use an enzyme called reverse transcriptase to make a copy of DNA from RNA.

All cells, from bacteria to humans, express their genetic information in this way—a principle so fundamental that it is termed the central dogma of molecular biology. Despite the universality of the central dogma of molecular biology, there are important variations between organisms in the way in which information flows from DNA to protein. Principal among these is that RNA transcripts in eukaryotic cells are subject to a series of processing steps in the nucleus, including RNA splicing, before they are permitted to exit from the nucleus and be translated into protein. These processing steps can critically change the “meaning” of an RNA molecule and are therefore crucial for understanding how eukaryotic cells read their genome. For many genes, RNA is the final product. Like proteins, some of these RNAs fold into precise three-dimensional structures that have structural and catalytic roles in the cell. Other RNAs  act primarily as regulators of gene expression. But the roles of many noncoding RNAs are not yet known.

One might have predicted that the information present in genomes would be arranged in an orderly fashion, resembling a dictionary or a telephone directory. But it turns out that the genomes of most multicellular organisms are surprisingly disorderly. The genes in these organisms largely consist of a long string of alternating short exons and long introns. Moreover, small bits of DNA sequence that code for protein are interspersed with large blocks of seemingly meaningless DNA. Some sections of the genome contain many genes and others lack genes altogether. Proteins that work closely with one another in the cell often have their genes located on different chromosomes, and adjacent genes typically encode proteins that have little to do with each other in the cell. Decoding genomes is, therefore, no simple matter. Even with the aid of powerful computers, it is difficult for researchers to locate definitively the beginning and end of genes, much less to decipher when and where each gene is expressed in the life of the organism. Yet the cells do this automatically, thousands of times a second.

Much has been learned about how the genetic instructions written in an alphabet of just four “letters”—the four different nucleotides in DNA—direct the formation of an organism. Nevertheless, we still have a great deal to discover about how the information stored in an organism’s genome produces even the simplest unicellular bacterium with 500 genes, let alone how it directs the development of a human with approximately 30,000 genes. An enormous amount of ignorance remains; many fascinating challenges, therefore, await the next generation of researchers.

A cell can change (or regulate) the expression of each of its genes according to its needs—most commonly by controlling the production of its RNA.

The DNA double helix
The determination of the structure of DNA by James Watson and Francis Crick in 1953 is often said to mark the birth of modern molecular biology. The Watson–Crick structure of DNA not only provided a model of what is arguably the central molecule of life, it also suggested the molecular mechanism of heredity. Watson and Crick’s accomplishment, which is ranked as one of science’s major intellectual achievements, was based in part on two pieces of evidence in addition to Chargaff ’s rules: the correct tautomeric forms of the bases and indications that DNA is a helical molecule. Evidence that DNA is a helical molecule was provided by an X-ray diffraction photograph of a DNA fiber taken by Rosalind Franklin. The limited structural information, along with Chargaff ’s rules, provided few clues to the structure of DNA; Watson and Crick’s model sprang mostly from their imaginations and model-building studies. Once the Watson–Crick model had been published, however, its basic simplicity combined with its obvious biological relevance led to its rapid acceptance. Later investigations have confirmed the general validity of the Watson–Crick model, although its details have been modified. The Watson–Crick structure can accommodate any sequence of bases on one polynucleotide strand if the opposite strand has the complementary base sequence. This immediately accounts for Chargaff ’s rules. More importantly, it suggests that each DNA strand can act as a template for the synthesis of its complementary strand and hence that hereditary information is encoded in the sequence of bases on either strand.

The genome is like a computer hard disk, being the  medium that stores the blueprint of the organism through codified information


Francis Crick (right) and James Watson (left) point out features of their model for the structure of DNA.

Computers illustrate the mechanism by which living organisms store information. 1 The blueprint of life. Life uses various code systems, genetic and epigenetic, that is, systems inside the cell, but beside the genome, to instruct the cell how to perform its tasks. Double-stranded molecules of DNA are formed by nucleotides, which use a four-letter alphabet—A, T, C, G—and they are strung together in a long linear sequence that encodes the genetic information, just as the sequence of 1s and 0s encodes the information in a computer file. The DNA code is transcribed and translated, interpreted and deciphered by the Ribosome, or copied to replicate itself.  The mechanisms that make life possible depend on the structure of the double-stranded DNA molecule. Each monomer in a single DNA strand—that is, each nucleotide—consists of a sugar (deoxyribose), a phosphate group attached to it, and a base, which may be either adenine (A), guanine (G), cytosine (C), or thymine (T). Each sugar is linked to the next via the phosphate group, creating a polymer chain composed of a repetitive sugar-phosphate backbone with a series of bases protruding from it. The DNA polymer is extended by adding monomers at one end. For a single isolated strand, these monomers can, in principle, be added in any order, because each one links to the next in the same way, through the part of the molecule that is the same for all of them. In the living cell, however, DNA is not synthesized as a free strand in isolation, but on a template formed by a preexisting DNA strand. The bases protruding from the existing strand bind to bases of the strand being synthesized, according to a strict rule defined by the complementary structures of the bases: A binds to T, and C binds to G. This base-pairing holds fresh monomers in place and thereby controls the selection of which one of the four monomers shall be added to the growing strand next. In this way, a double-stranded structure is created, consisting of two exactly complementary sequences of As, Cs, Ts, and Gs. The two strands twist around each other, forming a DNA double helix.


The components of nucleotides. 
The three building blocks of a nucleotide are one or more phosphate groups, a sugar, and a base. The bases are categorized as purines (adenine and guanine) and pyrimidines (thymine, cytosine, and uracil).







The bonds between the base pairs are weak compared with the sugar-phosphate links, and this allows the two DNA strands to be pulled apart without breakage of their backbones. Each strand then can serve as a template, in the way just described, for the synthesis of a fresh DNA strand complementary to itself—a fresh copy, that is, of the hereditary information. In different types of cells, this process of DNA replication occurs at different rates, with different controls to start it or stop it, and different auxiliary molecules to help it along. But the basics are universal: DNA is the information store for heredity, and templated polymerization is the way in which this information is copied throughout the living world.



The information stored in DNA is transcribed into messenger RNA
In a factory, the engineer makes a blueprint. That blueprint can either be copied to be stored at another place, or sent to the factory and serve to construct the device of the blueprint. In life happens the same.  To carry out its information-bearing function, DNA must do more than copy itself. It must also express its information, by letting the information guide the synthesis of proteins and other molecules in the cell. This expression occurs by a mechanism that is the same in all living organisms, leading first and foremost to the production of  RNAs and proteins. The process begins with a process called transcription, in which segments of the DNA sequence are used as templates for the synthesis of shorter RNA molecules. Later, in the more complex process of translation, many of these RNA molecules direct the synthesis of proteins. In RNA, the backbone is formed of a slightly different sugar from that of DNA—ribose instead of deoxyribose—and one of the four bases is slightly different—uracil (U) in place of thymine (T). But the other three bases—A, C, and G—are the same, and all four bases pair with their complementary counterparts in DNA—the A, U, C, and G of RNA with the T, A, G, and C of DNA. During transcription, the RNA monomers are lined up and selected for polymerization on a template strand of DNA, just as DNA monomers are selected during replication. The outcome is a polymer molecule whose sequence of nucleotides faithfully represents a portion of the cell’s genetic information, even though it is written in a slightly different alphabet—consisting of RNA monomers instead of DNA monomers. The same segment of DNA can be used repeatedly to guide the synthesis of many identical RNA molecules. Thus, whereas the cell’s archive of genetic information in the form of DNA is fixed and sacrosanct, these RNA transcripts are mass-produced and disposable.

RNA Molecules Are Single-Stranded
The first step a cell takes in reading out a needed part of its genetic instructions is to copy a particular portion of its DNA nucleotide sequence—a gene—into an RNA nucleotide sequence (Figure 6–4). The information in RNA, although copied into another chemical form, is still written in essentially the same language as it is in DNA—the language of a nucleotide sequence. Hence the name given to producing RNA molecules on DNA is transcription. Like DNA, RNA is a linear polymer made of four different types of nucleotide subunits linked together by phosphodiester bonds.


A strand of RNA.
This structure is very similar to a DNA strand (see Figure 9.10), except that the sugar is ribose instead of deoxyribose, and uracil is substituted for thymine.

It differs from DNA chemically in two respects: 

(1) the nucleotides in RNA are ribonucleotides—that is, they contain the sugar ribose (hence the name ribonucleic acid) rather than deoxyribose; 
(2) although, like DNA, RNA contains the bases adenine (A), guanine (G), and cytosine (C), it contains the base uracil (U) instead of the thymine (T) in DNA. Since U, like T, can base-pair by hydrogen-bonding with A , the complementary base-pairing properties described for DNA  apply also to RNA (in RNA, G pairs with C, and A pairs with U). 

We also find other types of base pairs in RNA: for example, G occasionally pairs with U. Although these chemical differences are slight, DNA and RNA differ quite dramatically in overall structure. Whereas DNA always occurs in cells as a double-stranded helix, RNA is single-stranded. An RNA chain can therefore fold up into a particular shape, just as a polypeptide chain folds up to form the final shape of a protein. The ability to fold into complex three-dimensional shapes allows some RNA molecules to have precise structural and catalytic functions.

Who had the "good idea" to exchange  Thymine to Uracil2



 Figure 1 : The "mystery" of the exchange of uracil ( RNA for thymine (T) in the DNA. Who would have had such foresight, and such a chemical genius? 


One of the nitrogen bases used in RNA  is uracil (U), but this DNA base "appears" exchanged for thymine (T). But why? That question shows to be even more intriguing when we see that thymine and uracil differ only by a methyl more or less, and apparently, this change takes place in a "harmless" position in terms of interactions between bases that are primarily established through hydrogen bonds. Several explanations have been offered,  and today we know that this exchange U/T has an amazing logic. It was apparently a planned strategy with full mastery for any storage system and transmission of information, right from the beginning, accurately and efficiently. The importance of exchanging U/T can also be recognized by the great effort that the cell makes to process it. Such an exchange is made by the cell through the machinery of the cell, and uses a methylation reaction catalyzed by folic acid, which occurs before incorporation of T, and requires one of the nucleotides in DNA.

But why this exchange U/T so " tenue"? Everything indicates today that this exchange has two crucial and specific purposes: The first purpose is to increase the specificity pairing in DNA because it trades U of T, and T is much more selective in its pairing with adenine (A) in the duo A-T, or "Arnold - Timothy". The base U would also make a preferential pairing with A, but not as selectively,  since U can pair also efficiently with all other bases, including itself. This selectivity is best explained if we remember that DNA is made of nucleic acids, phosphates, and sugar molecules which are hydrophilic and - water-soluble - and the addition of a hydrophobic methyl causes it to be repelled from the rest of the DNA, moving it to a specific position on the helice that makes  T bind exclusively with A, increasing the efficiency of DNA to store and transmit information. Methylation which exchanges U with T is, therefore a strategy of increasing the integrity of the information that needs to be at maximum capacity in  DNA. Being an immense and fundamental nanomolecular software,  DNA can't do any wrong, and everything in it seems that was planned to minimize pairing and reading errors. Another reason for methylation and exchange of U/T also seems to relate to the integrity of information. It is known that cytosine (C) in DNA suffers over time, a reaction of deamination, thereby turning slowly into U (Figure 1).

This deamination C generates a  "foreign" U base in  DNA. In RNA, this deamination is not worrisome because  RNA is quickly used and recycled, and there is not enough time to accumulate this "error". But DNA has a lifetime much longer and so this "damage", via natural degradation, becomes critical. And without proper repair, the deamination of C in U would be catastrophic. Who or what designed  DNA, then - blind unguided evolutionary processes or chance ( since there was no evolution prior DNA replication ),  or a intelligent mind - realizing and considering this deadly obstacle, that would cause a point mutation, deleterious, random and frequently, which used his foresight capacity, and solved the problem in two ingenious ways ?  If U would not have been swapped into T in DNA, the cell would not know and recognize what would be a  "legitimate", or an "illegitimate" U, and that U "alien" formed by the degradation of C. But just changing the U of T,  DNA would only be able  to recognize each and every U as" alien ", but how to eliminate it? For this, another ingenious solution was found to create a machinery and a repair enzyme - the "uracil DNA glycosylase"  - that is used specifically to correct this natural, seemingly "inevitable" defect. The exchange of U/T appears well be a spectacle of irreducible complexity associated with brilliant foresight that, according to scientific design detection methods, provides seemingly irrefutable evidence of intelligence that created life. Well, there is another hypothesis, that evolution has created such a process via a 'frozen accident "[frozen accident] or simply chance. Something that would have happened slow, gradual and successively by unguided natural processes. Do you believe in miracles without a saint that  synchronized these miracles? You decide and choose.

The Dilemma of exchanging U/T. Notice here a huge dilemma. Assume now that life started in an event known as "RNA world". Lets put aside for a moment the enormous difficulties encountered to justify the synthesis, catalysis, and transformation in DNA of this "primordial RNA", and imagine - since only imagination seems to work here - that in fact,  RNA gave rise to DNA. But one that uses the same DNA bases of RNA, U and C together, and not T and C as "intelligent DNA" today, it would be "fatal" to Life. As seen, the use of the T in the DNA would cause a catastrophic confusion because the natural deamination of C to T in the DNA-RNA processing would be feasible, evolution would have required, before the DNA-based Life existed,  the foresight of a brilliant providing, a priori, all the U T methylation machinery before replacing such "primordial RNA" into the primordial DNA, and at the same time and in the same "miraculous" place, provide to the "newborn" DNA an efficient mechanism of enzymatic repair replacing U by C. Two chemistry "miracles", and simultaneously would have to occur synchronically. Incidentally, three miracles, because the machinery removed from the hydroxyl of RNA ribose would have to be there too, but running the DNA was degraded too fast, 100 times too fast. And life could not wait for the chance to regain viability. Chance or design?

Transcription Produces RNA Complementary to One Strand of DNA
The RNA in a cell is made by DNA transcription, a process that has certain similarities to the process of DNA replication. Transcription begins with the opening and unwinding of a small portion of the DNA double helix to expose the bases on each DNA strand. One of the two strands of the DNA double helix then acts as a template for the synthesis of an RNA molecule. As in DNA replication, the nucleotide sequence of the RNA chain is determined by the complementary base-pairing between incoming nucleotides and the DNA template.

Overview of Transcription 
One key concept important in the process of transcription is that short base sequences define the beginning and ending of a gene and also play a role in regulating the level of RNA synthesis. The functions of regulatory For genes to be actively transcribed, proteins must recognize particular DNA sequences and act on them in a way that affects the transcription process. At the molecular level, gene expression is the overall process by which the information within a gene is used to produce a functional product, such as a polypeptide.


Organization of sequences of a bacterial gene and its mRNA transcript. 
This figure depicts the general organization of sequences that are needed to create a functional gene that encodes an mRNA.

For a gene to be expressed, a few different types of base sequences perform specific roles. The figure above shows a common organization of base sequences needed to create a structural gene that functions in a bacterium such as
E. coli. Each type of base sequence performs its role during a particular stage of gene expression. For example, the promoter and terminator are base sequences used during gene transcription. Specifically, the promoter provides a site to begin transcription, and the terminator specifies the end of transcription. These two sequences cause RNA synthesis to occur within a defined location. The DNA is transcribed into RNA from the end of the promoter to the terminator. As described later, the base sequence in the RNA transcript is complementary to the template strand of DNA. The opposite strand is the nontemplate strand. For structural genes, the nontemplate strand is also called the coding strand because its sequence is the same as the transcribed mRNA that encodes a polypeptide, except that the DNA has T’s in places where the mRNA contains U’s.

A category of proteins called transcription factors recognizes base sequences in the DNA and controls transcription. Some transcription factors bind directly to the promoter and facilitate transcription. Other transcription factors recognize regulatory sequences, or regulatory elements —short stretches of DNA involved in the regulation of transcription. Certain transcription factors bind to such regulatory sequences and increase the rate of transcription while others inhibit transcription. Base sequences within an mRNA are used during the translation process. In bacteria, a short sequence within the mRNA, the ribosome -binding site, provides a location for the ribosome to bind and begin translation. The bacterial ribosome recognizes this site because it is complementary to a sequence in ribosomal RNA. In addition, mRNA contains a series of codons, read as groups of three nucleotides, which contain the information for a polypeptide’s sequence. The first codon, which is very close to the ribosome-binding site, is the start codon. This is followed by many more codons that dictate the sequence of amino acids within the synthesized polypeptide. Finally, a stop codon signals the end of translation. 

The three stages of transcription are Initiation, Elongation, and Termination
Transcription occurs in three stages: initiation; elongation, or synthesis of the RNA transcript; and termination.


Stages of transcription.
The ability of genes to produce an organism’s traits relies on the molecular process of gene expression. Transcription is the first step in gene expression. During transcription, the gene’s sequence within the DNA is used as a template to make a complimentary copy of RNA.

These steps involve protein-DNA interactions in which proteins such as RNA polymerase, the enzyme that synthesizes RNA, interact with DNA sequences. What causes transcription to begin? The initiation stage in the transcription process is a recognition step. The sequence of bases within the promoter region is recognized by transcription factors. The specific binding of transcription factors to the promoter sequence identifies the starting site for transcription.
Transcription factors and RNA polymerase first bind to the promoter region when the DNA is in the form of a double helix. For transcription to occur, the DNA strands must be separated. This allows one of the two strands to be used as a template for the synthesis of a complementary strand of RNA. This synthesis occurs as RNA polymerase slides along the DNA, forming a small bubble-like structure known as the open promoter complex, or simply as the open complex. Eventually, RNA polymerase reaches a terminator, which causes both RNA polymerase and the newly made RNA transcript to dissociate from the DNA.

RNA Transcripts Have Different Functions
Once they are made, RNA transcripts play different functional roles (Table below ). 



Well over 90% of all genes are structural genes, which are transcribed into mRNA. For structural genes, mRNAs are made first, but the final, functional products are polypeptides that are components of proteins. The remaining types of RNAs described in the Table above are never translated. The RNA transcripts from such nonstructural genes have various important cellular functions. For nonstructural genes, the functional product is the RNA. In some cases, the RNA transcript becomes part of a complex that contains both protein subunits and one or more RNA molecules. Examples of protein-RNA complexes include ribosomes, signal recognition particles, RNaseP, spliceosomes, and telomerase.

Transcription in Bacteria
The first suggestion that RNA is derived from the transcription of DNA was made by Elliot Volkin and Lazarus Astrachan in 1956. In 1960, Matthew Meselson and François Jacob found that proteins are synthesized on ribosomes. One year later, Jacob and his colleague Jacques Monod proposed that a certain type of RNA acts as a genetic messenger (from the DNA to the ribosome) to provide the information for protein synthesis. They hypothesized that this RNA, which they called messenger RNA (mRNA), is transcribed from the sequence within DNA and then directs the synthesis of particular polypeptides. In the early 1960s, this proposal was remarkable, considering that it was made before the actual isolation and characterization of the mRNA molecules in vitro. In 1961, the hypothesis was confirmed by Sydney Brenner in collaboration with Jacob and Meselson. They found that when a virus infects a bacterial cell, a virus-specific RNA is made that rapidly associates with preexisting ribosomes in the cell. Since these pioneering studies, a great deal has been learned about the molecular features of bacterial gene transcription. Much of our knowledge comes from studies of E. coli.


A Promoter Is a short sequence of DNA that is necessary to initiate transcription
The type of DNA sequence known as the promoter gets its name from the idea that it “promotes” gene expression. More precisely, this sequence of bases directs the exact location for the initiation of RNA transcription. Most of the promoter region is located just ahead of or upstream from the site where transcription of a gene actually begins. By convention, the bases in a promoter sequence are numbered in relation to the transcriptional start site (Figure
below ).


The conventional numbering system of promoters
The first nucleotide that acts as a template for transcription is designated +1. The numbering of nucleotides to the left of this spot is in a negative direction, whereas the numbering to the right is in a positive direction. For example, the nucleotide that is immediately to the left of the +1 nucleotide is numbered –1, and the nucleotide to the right of the +1 nucleotide is numbered +2. There is no zero nucleotide in this numbering system. In many bacterial promoters, sequence elements at the –35 and –10 regions play a key role in promoting transcription.

This site is the first base used as a template for RNA transcription and is denoted +1. The bases preceding this site are numbered in a negative direction. No base is numbered zero. Therefore, most of the promoter region is labeled with negative numbers that describe the number of bases preceding the beginning of transcription. Although the promoter may encompass a region several dozen nucleotides in length, short sequence elements are particularly critical for promoter recognition. By comparing the sequence of DNA bases within many promoters, researchers have learned that certain sequences of bases are necessary to create a functional promoter. In many promoters found in E. coli and similar species, two sequence elements are important. These are located at approximately the –35 and –10 sites in the promoter region (see Figure above). The sequence in the top DNA strand at the –35 region is 5ʹ –TTGACA–3ʹ, and the one at the –10 region is 5ʹ–TATAAT–3ʹ. The TATAAT sequence is called the Pribnow box after David Pribnow, who initially discovered it in 1975. The sequences at the –35 and –10 sites can vary among different genes. For example, the Figure below illustrates the sequences found in several different E. coli promoters.


Examples of –35 and –10 sequences within a variety of bacterial promoters. 
This figure shows the –35 and –10 sequences for one DNA strand found in seven different bacterial and bacteriophage promoters. The consensus sequence is shown at the bottom. The spacer regions contain the designated number of nucleotides between the –35 and –10 region or between the –10 region and the transcriptional start site. For example, N17 means there are 17 nucleotides between the end of the –35 region and the beginning of the –10 region.

The most commonly occurring bases within a sequence element form the consensus sequence. This sequence is efficiently recognized by proteins that initiate transcription. For many bacterial genes, a strong correlation is found between the maximal rate of RNA transcription and the degree to which the –35 and –10 regions agree with their consensus sequences.

Bacterial transcription is initiated when RNA Polymerase Holoenzyme binds at a promoter sequence
Thus far, we have considered the DNA sequences that constitute a functional promoter. Let’s now turn our attention to the proteins that recognize those sequences and carry out the transcription process. The enzyme that catalyzes the synthesis of RNA is RNA polymerase . In E. coli, the core enzyme is composed of five subunits, α2ββʹω . The association of a sixth subunit, sigma ( σ) factor, with the core enzyme is referred to as RNA polymerase holoenzyme. The different subunits within the holoenzyme play distinct functional roles. The two α subunits are important in the proper assembly of the holoenzyme and in the process of binding to DNA. The β and βʹ subunits are also needed for binding to the DNA and carry out the catalytic synthesis of RNA. The ω (omega) subunit is important for the proper assembly of the core enzyme. The holoenzyme is required to initiate transcription; the primary role of σ factor is to recognize the promoter. Proteins, such as σ factor, that influence the function of RNA polymerase are types of transcription factors. After RNA polymerase holoenzyme is assembled into its six subunits, it binds loosely to the DNA and then slides along the DNA, much as a train rolls down the tracks. How is a promoter identified? When the holoenzyme encounters a promoter sequence, σ factor recognizes the bases at both the –35 and –10 regions. σ factor protein contains a structure called a helix-turnhelix motif that can bind tightly to these regions. Alpha (α) helices within the protein fit into the major groove of the DNA double helix and form hydrogen bonds with the bases. This phenomenon of molecular recognition is shown in Figure below .


The binding of σ factor protein to the DNA double helix. 
In this example, the protein contains two α helices connected by a turn, termed a helix-turn-helix motif. Two α helices of the protein can fit within the major groove of the DNA. Amino acids within the α helices form hydrogen bonds with the bases in the DNA.

Hydrogen bonding occurs between nucleotides in the –35 and–10 regions of the promoter and amino acid side chains in the helix-turn-helix structure of σ factor. As shown in Figure below, the process of transcription is
initiated when σ factor within the holoenzyme has bound to the promoter region to form the closed complex.


The initiation stage of transcription in bacteria 
The σ factor subunit of the RNA polymerase holoenzyme recognizes the –35 and –10 regions of the promoter. The DNA unwinds in the –10 region to form an open complex, and a short RNA is made. σ factor then dissociates from the holoenzyme, and the RNA polymerase core enzyme can proceed down the DNA to transcribe RNA, forming an open complex as it goes.

For transcription to begin, the double-stranded DNA must then be unwound into an open complex. This unwinding first occurs at the TATAAT sequence in the –10 region, which contains only AT base pairs, as shown in Figure The conventional numbering system of promoters.. AT base pairs form only two hydrogen bonds, whereas GC pairs form three. Therefore, DNA in an AT-rich region is more easily separated because fewer hydrogen bonds must be broken. A short strand of RNA is made within the open complex, and then σ factor is released from the core enzyme. The release of σ factor marks the transition to the elongation phase of transcription. The core enzyme may now slide down the DNA to synthesize a strand of RNA.


The RNA transcript Is synthesized during the elongation stage
After the initiation stage of transcription is completed, the RNA transcript is made during the elongation stage. During the synthesis of the RNA transcript, RNA polymerase moves along the DNA, causing it to unwind (Figure below ).


Synthesis of the RNA transcript

As previously mentioned, the DNA strand used as a template for RNA synthesis is called the template, or antisense, strand. The opposite DNA strand is the coding, or sense, strand; it has the same sequence as the RNA transcript except that T in the DNA corresponds to U in the RNA. Within a given gene, only the template strand is used for RNA synthesis, whereas the coding strand is never used. As it moves along the DNA, the open complex formed by the action of RNA polymerase is approximately 17 bp long. On average, the rate of RNA synthesis is about 43 nucleotides per second! Behind the open complex, the DNA rewinds back into a double helix. As described in the Figure above, the chemistry of transcription by RNA polymerase is similar to the synthesis of DNA via DNA polymerase. RNA polymerase always connects nucleotides in the 5ʹ to 3ʹ direction. During this process, RNA polymerase catalyzes the formation of a bond between the 5ʹ phosphate group on one nucleotide and the 3ʹ–OH group on the previous nucleotide. The complementarity rule is similar to the AT/GC rule, except that uracil substitutes for thymine
in the RNA. In other words, RNA synthesis obeys an ADNA-URNA/ TDNA-ARNA/GDNA-CRNA/CDNA-GRNA rule. When considering the transcription of multiple genes within a chromosome, the direction of transcription and the
DNA strand used as a template varies among different genes. The figure below shows three genes adjacent to each other within a chromosome.


The transcription of three different genes found in the same chromosome 
RNA polymerase synthesizes each RNA transcript in a 5ʹ to 3ʹ direction, sliding along a DNA template strand in a 3ʹ to 5ʹ direction. However, the use of the template strand varies from gene to gene. For example, genes A and B use the bottom strand, but gene C uses the top strand.

Genes A and B are transcribed from left to right, using the bottom DNA strand as a template. By comparison, gene C is transcribed from right to left and uses the top DNA strand as a template. Note that in all three cases, the template strand is read in the 3ʹ to 5ʹ direction, and the synthesis of the RNA transcript occurs in a 5ʹ to 3ʹ direction.

Transcription Is terminated by either an RNA-binding protein or an intrinsic terminator
The end of RNA synthesis is referred to as termination. Prior to termination, the hydrogen bonding between the DNA and RNA within the open complex is of central importance in preventing dissociation of RNA polymerase from the template strand. Termination occurs when this short RNA-DNA hybrid region is forced to separate, thereby releasing RNA polymerase as well as the newly made RNA transcript. In E. coli, two different mechanisms for termination have been identified. For certain genes, an RNA-binding protein known as ρ (rho) is responsible for terminating transcription, in a mechanism called ρ-dependent termination. For other genes, termination does not require the involvement of the ρ protein. This is referred to as ρ-independent termination. In ρ-dependent termination, the termination process requires two components. First, a sequence upstream from the terminator, called the rut site for rho utilization site, acts as a recognition site for the binding of the ρ protein (Figure below ).


ρ-Dependent termination

How does ρ protein facilitate termination? The ρ protein functions as a helicase, an enzyme that can separate RNA-DNA hybrid regions. After the rut site is synthesized in the RNA, ρ protein binds to the RNA and moves in the direction of RNA polymerase. The second component of ρ-dependent termination is the site where termination actually takes place. At this terminator site, the DNA encodes an RNA sequence containing several GC base pairs that form a stem-loop structure. RNA synthesis terminates several nucleotides beyond this stem-loop. A stem-loop structure, also called a hairpin, can form due to complementary sequences within the RNA. This stem-loop forms almost immediately after the RNA sequence is synthesized and quickly binds to RNA polymerase. This binding results in a conformational change that causes RNA polymerase to pause in its synthesis of RNA. The pause allows ρ protein to catch up to the stem-loop, pass through it, and break the hydrogen bonds between the DNA and RNA within the open complex. When this occurs, the completed RNA strand is separated from the DNA along with RNA polymerase. Let’s now turn our attention to ρ-independent termination, a process that does not require the ρ protein. In this case, the terminator is composed of two adjacent nucleotide sequences that function within the RNA (Figure below ).


ρ-Independent or intrinsic termination
When RNA polymerase reaches the end of the gene, it transcribes a uracil-rich sequence. As this uracil-rich sequence is transcribed, stem-loop forms just upstream from the open complex. The formation of this stem-loop causes RNA polymerase to pause in its synthesis of the transcript. This pausing is stabilized by NusA, which binds near the region where RNA exits the open complex. While it is pausing, the RNA in the RNA-DNA hybrid is a uracil-rich sequence. Because hydrogen bonds between U and A are relatively weak interactions, the transcript and RNA polymerase dissociates from the DNA.

One is a uracilrich sequence located at the 3ʹ end of the RNA. The second sequence is adjacent to the uracil-rich sequence and promotes the formation of a stem-loop structure. As shown in above Figure, the formation of the stem-loop causes RNA polymerase to pause in its synthesis of RNA. This pausing is stabilized by other proteins that bind to RNA polymerase. For example, a protein called NusA, which is bound to RNA polymerase, promotes pausing at stemloop sequences. At the precise time, RNA polymerase pauses, the uracil-rich sequence in the RNA transcript is bound to the DNA template strand. As previously mentioned, the hydrogen bonding of RNA to DNA keeps RNA polymerase clamped onto the DNA. However, the binding of this uracil-rich sequence to the DNA template strand is relatively weak, causing the RNA transcript to spontaneously dissociate from the DNA and cease further transcription. Because this process does not require a protein (the ρ protein) to physically remove the RNA transcript from the DNA, it is also referred to as intrinsic termination. In E. coli, about half of the genes show intrinsic termination, and the other half are terminated by ρ protein.

Transcription in eukaryotes 
Many of the basic features of gene transcription are very similar in bacterial and eukaryotic species. Much of our understanding of transcription has come from studies in Saccharomyces cerevisiae (baker’s yeast) and other eukaryotic species, including mammals. In general, gene transcription in eukaryotes is more complex than that of their bacterial counterparts. Eukaryotic cells are larger and contain a variety of compartments known as organelles. This added level of cellular complexity dictates that eukaryotes contain many more genes encoding cellular proteins. In addition, most eukaryotic species are multicellular, being composed of many different cell types. Multicellularity adds the requirement that genes be transcribed in the correct type of cell and during the proper stage of development. Therefore, in any given species, the transcription of the thousands of different genes that an organism possesses requires appropriate timing and coordination. An important factor that affects eukaryotic gene transcription is chromatin structure. Eukaryotic gene transcription requires changes in the positions and structures of nucleosomes.

Eukaryotes have multiple RNA Polymerases that are structurally similar to the bacterial enzyme
The genetic material within the nucleus of a eukaryotic cell is transcribed by three different RNA polymerase enzymes, designated RNA polymerase I, II, and III. What are the roles of these enzymes? Each of the three RNA polymerases transcribes different categories of genes. RNA polymerase I transcribes all of the genes that encode ribosomal RNA (rRNA) except for the 5S rRNA. RNA polymerase II plays a major role in cellular transcription because it transcribes all of the structural genes. It is responsible for the synthesis of all mRNA and also transcribes certain snRNA genes, which are needed for pre-mRNA splicing. RNA polymerase III transcribes all tRNA genes and the 5S rRNA gene. All three RNA polymerases are structurally very similar and are composed of many subunits. They contain two large catalytic subunits similar to the β and βʹ subunits of bacterial RNA polymerase. The structures of RNA polymerase from a few different species have been determined by X-ray crystallography. A remarkable similarity exists between the bacterial enzyme and its eukaryotic counterparts. Figure a below compares the structures of a bacterial RNA polymerase with RNA polymerase II from yeast.


Structure and molecular function of RNA polymerase. 
(a) A comparison of the crystal structures of a bacterial RNA polymerase (left) to a eukaryotic RNA polymerase II (right). The bacterial enzyme is from Thermus aquaticus. The eukaryotic enzyme is from Saccharomyces cerevisiae. 
(b) A mechanism for transcription based on the crystal structure. In this diagram, the direction of transcription is from left to right. The double-stranded DNA enters the polymerase along a bridge surface that is between the jaw and clamp. At a region termed the wall, the RNA-DNA hybrid is forced to make a right-angle turn, which enables nucleotides to bind to the template strand. Mg2+ is located at the catalytic site. Nucleoside triphosphates (NTPs) enter the catalytic site via a pore region and bind to the template DNA. At the catalytic site, the nucleotides are covalently attached to the 3ʹ end of the RNA. As RNA polymerase slides down the template, a small region of the protein termed the rudder separates the RNA-DNA hybrid. The single-stranded RNA then exits under a small lid.

DNA enters the enzyme through the jaw and lies on a surface within RNA polymerase termed the bridge. The part of the enzyme called the clamp is thought to control the movement of the DNA through RNA polymerase. A wall in the enzyme forces the RNA-DNA hybrid to make a right-angle turn. This bend facilitates the ability of nucleotides to bind to the template strand. Mg2+ is located at the catalytic site, which is precisely at the 3ʹ end of the growing RNA strand. Nucleoside triphosphates (NTPs) enter the catalytic site via a pore region. The correct nucleotide binds to the template DNA and is covalently attached to the 3ʹ end. As RNA polymerase slides down the template, a rudder, which is about 9 bp away from the 3ʹ end of the RNA, forces the RNA-DNA hybrid apart. The single-stranded RNA then exits under a small lid.

Eukaryotic structural genes have a core promoter and regulatory elements
In eukaryotes, the promoter sequence is more variable and often more complex than that found in bacteria. For structural genes, at least three features are found in most promoters: regulatory elements, a TATA box, and a transcriptional start site. The figure below shows a common pattern of sequences found within the promoters of eukaryotic structural genes.


A common pattern found for the promoter of structural genes recognized by RNA polymerase II 
The start site usually occurs at adenine; two pyrimidines (Py: cytosine or thymine) and a cytosine precede this adenine, and five pyrimidines (Py) follow it. A TATA box is approximately 25 bp upstream. However, the sequences that constitute eukaryotic promoters are quite diverse, and not all structural genes have a TATA box. Regulatory elements, such as GC or CAAT boxes, vary in their locations but are often found in the –50 to –100 region. The core promoters for RNA polymerase I and III are quite different. A single upstream regulatory element is involved in the binding of RNA polymerase I to its promoter, whereas two regulatory elements, called A and B boxes, facilitate the binding of RNA polymerase III.

The core promoter is a relatively short DNA sequence that is necessary for transcription to take place. It consists of a TATAAA sequence called the TATA box and the transcriptional start site, where transcription begins. The TATA box, which is usually about 25 bp upstream from a transcriptional start site, is important in determining the precise starting point for transcription. If it is missing from the core promoter, the transcription start site point becomes undefined, and transcription may start at a variety of different locations. The core promoter, by itself, produces a low level of transcription. This is termed basal transcription. Regulatory elements are short DNA sequences that affect the ability of RNA polymerase to recognize the core promoter and begin the process of transcription. These elements are recognized by transcription factors—proteins that bind to regulatory elements and influence the rate of transcription. There are two categories of regulatory elements. Activating sequences, known as enhancers, are needed to stimulate transcription. In the absence of enhancer sequences, most eukaryotic genes have very low levels of basal transcription. Under certain conditions, it may also be necessary to prevent transcription of a given gene. This occurs via silencers—DNA sequences that are recognized by transcription factors that inhibit transcription. As seen in Figure above, a common location for regulatory elements is the –50 to –100 region. However, the locations of regulatory elements vary considerably among different eukaryotic genes. These elements can be far away from the core promoter yet strongly influence the ability of RNA polymerase to initiate transcription. DNA sequences such as the TATA box, enhancers, and silencers exert their effects only over a particular gene. They are called cis-acting elements. The term cis comes from chemistry nomenclature meaning “next to.” Cis-acting elements, though possibly far away from the core promoter, are always found within the same chromosome as the genes they regulate. By comparison, the regulatory transcription factors that bind to such elements are called trans-acting factors (the term trans means “across from”). The transcription factors that control the expression of a gene are themselves encoded by genes; regulatory genes that encode transcription factors may be far away from the genes they control. When a gene encoding a trans-acting factor is expressed, the transcription factor protein that is made can diffuse throughout the cell and bind to its appropriate cis-acting element.

Transcription of eukaryotic structural genes is initiated when RNA Polymerase II and general transcription factors bind to a promoter sequence
Thus far, we have considered the DNA sequences that play a role in the promoter region of eukaryotic structural genes. By studying transcription in a variety of eukaryotic species, researchers have discovered that three categories of proteins are needed for basal transcription at the core promoter: RNA polymerase II, general transcription factors, and mediator (Table below ).



Five different proteins called general transcription factors (GTFs) are always needed for RNA polymerase II to initiate transcription of structural genes. Figure below describes the assembly of GTFs and RNA polymerase II at the TATA box. 


Steps leading to the formation of the open complex

As shown here, a series of interactions lead to the formation of the open complex. Transcription factor IID (TFIID) first binds to the TATA box and thereby plays a critical role in the recognition of the core promoter. TFIID is composed of several subunits, including TATA-binding protein (TBP), which directly binds to the TATA box, and several other proteins called TBP-associated factors (TAFs). After TFIID binds to the TATA box, it associates with TFIIB. TFIIB promotes the binding of RNA polymerase II and TFIIF to the core promoter. Lastly, TFIIE and TFIIH bind to the complex. This completes the assembly of proteins to form a closed complex, also known as a preinitiation complex. TFIIH plays a major role in the formation of the open complex. TFIIH has several subunits that perform different functions. Certain subunits act as helicases, which break the hydrogen bonding between the double-stranded DNA and thereby promote the formation of the open complex. Another subunit hydrolyzes ATP and phosphorylates a domain in RNA polymerase II known as the carboxyl terminal domain (CTD). Phosphorylation of the CTD releases the contact between RNA polymerase II and TFIIB. Next, TFIIB, TFIIE, and TFIIH dissociate, and RNA polymerase II is free to proceed to the elongation stage of transcription. In vitro, when researchers mix together TFIID, TFIIB, TFIIF, TFIIE, TFIIH, RNA polymerase II, and a DNA sequence containing a TATA box and transcriptional start site, the DNA is transcribed into RNA. Therefore, these components are referred to as the basal transcription apparatus. In a living cell, however, additional components regulate transcription and allow it to proceed at a reasonable rate. In addition to GTFs and RNA polymerase II, another component required for transcription is a large protein complex termed mediator. This complex was discovered by Roger Kornberg and colleagues in 1990. In 2006, Kornberg was awarded the Nobel Prize in chemistry for his studies regarding the molecular basis of eukaryotic transcription. Mediator derives its name from the observation that it mediates interactions between RNA polymerase II and regulatory transcription factors that bind to enhancers or silencers. It serves as an interface between RNA polymerase II and many diverse regulatory signals. The subunit composition of mediator is quite complex and variable. The core subunits form an elliptically shaped complex that partially wraps around RNA polymerase II. Mediator itself may phosphorylate the CTD of RNA polymerase II, and it may regulate the ability of TFIIH to phosphorylate the CTD. Therefore, it can play a pivotal role in the switch between transcriptional initiation and elongation.

Transcriptional termination of RNA Polymerase II occurs after the 3ʹ end of the transcript is cleaved near the PolyA signal sequence
Eukaryotic pre-mRNAs are modified by cleavage near their 3ʹ end and the subsequent attachment of a string of adenine nucleotides. This processing, which is called polyadenylation, requires a polyA signal sequence that directs the cleavage of the pre-mRNA. Transcription via RNA polymerase II typically terminates about 500 to 2000 nucleotides downstream from the polyA signal.
Figure below shows a simplified scheme for the transcriptional termination of RNA polymerase II.


Possible mechanisms for transcriptional termination of RNA polymerase II.

After RNA polymerase II has transcribed the polyA signal sequence, the RNA is cleaved just downstream from this sequence. This cleavage occurs before transcriptional termination. Two models have been proposed for transcriptional termination. According to the allosteric model, RNA polymerase II becomes destabilized after it has transcribed the polyA signal sequence, and it eventually dissociates from the DNA. This destabilization may be caused by the loss of proteins that function as elongation factors or by the binding of proteins that function as termination factors. A second model, called the torpedo model, suggests that RNA polymerase II is physically removed from the DNA. According to this model, the region of RNA that is downstream from the polyA signal sequence is cleaved by an exonuclease that degrades the transcript in the 5ʹ to 3ʹ direction. When the exonuclease catches up to RNA polymerase II, this causes RNA polymerase II to dissociate from the DNA. Which of these two models is correct? Additional research is needed, but the results of studies over the past few years have provided evidence that the two models are not mutually exclusive. Therefore, both mechanisms may play a role in transcriptional termination.

RNA modification
During the 1960s and 1970s, studies in bacteria established the physical structure of the gene. The analysis of bacterial genes showed that the sequence of DNA within the coding strand corresponds to the sequence of nucleotides in the mRNA, except that T is replaced with U. During translation, the sequence of codons in the mRNA is then read, providing the instructions for the correct amino acid sequence in a polypeptide. The one-toone correspondence between the sequence of codons in the DNA coding strand and the amino acid sequence of the polypeptide has been termed the colinearity of gene expression. The situation dramatically changed in the late 1970s, when the tools became available to study eukaryotic genes at the molecular level. The scientific community was astonished by the discovery that eukaryotic structural genes are not always colinear with their functional mRNAs. Instead, the coding sequences within many eukaryotic genes are separated by DNA sequences that are not translated into protein. The coding sequences are found within exons, which are regions that are contained within mature RNA. By comparison, the sequences that are found between the exons are called intervening sequences, or introns. During transcription, an RNA is made corresponding to the entire gene sequence. Subsequently, as it matures, the sequences in the RNA that correspond to the introns are removed and the exons are connected, or spliced, together. This process is called RNA splicing. Since the 1970s, research has revealed that splicing is a common genetic phenomenon in eukaryotic species. Splicing occurs occasionally in bacteria as well. Aside from splicing, research has also shown that RNA transcripts can be modified in several other ways. Table below describes the general types of RNA modifications.


For example, rRNAs and tRNAs are synthesized as long transcripts that are processed into smaller functional pieces. In addition, most eukaryotic mRNAs have a cap attached to their 5ʹ end and a tail attached at their 3ʹ end. In this section, we will examine the molecular mechanisms that account for several types of RNA modifications and consider why they are functionally important.

Some large RNA transcripts are cleaved into smaller functional transcripts
For many nonstructural genes, the RNA transcript initially made during gene transcription is processed or cleaved into smaller pieces. As an example, Figure below shows the processing of mammalian ribosomal RNA. The ribosomal RNA gene is transcribed by RNA polymerase I to make a long primary transcript, known as 45S rRNA. The term 45S refers to the sedimentation characteristics of this transcript in Svedberg units. Following the synthesis of the 45S rRNA, cleavage occurs at several points to produce three fragments, termed 18S, 5.8S, and 28S rRNA. These are functional rRNA molecules that play a key role in forming the structure of the ribosome. In eukaryotes, the cleavage of 45S rRNA into smaller rRNAs and the assembly of ribosomal subunits occur in a structure within the cell nucleus known as the nucleolus. The production of tRNA molecules requires processing via exonucleases and endonucleases. An exonuclease is a type of enzyme that cleaves a covalent bond between two nucleotides at one end of a strand. Starting at one end, an exonuclease can digest a strand, one nucleotide at a time. Some exonucleases can begin this digestion only from the 3ʹ end, traveling in the 3ʹ to 5ʹ direction, whereas others can begin only at the 5ʹ end and digest in the 5ʹ to 3ʹ direction. By comparison, an endonuclease can cleave the bond between two adjacent nucleotides within a strand. Like ribosomal RNA, tRNAs are synthesized as large precursor tRNAs that must be cleaved to produce mature, functional tRNAs that bind to amino acids. This processing has been studied extensively in E. coli.



1. Molecular biology of the cell, 6th edition, page 299
2. https://www.widbook.com/ebook/chapters/life-and-the-universe-by-intelligent-design
3. http://sphweb.bumc.bu.edu/otlt/MPH-Modules/PH/DNA-Genetics/DNA-Genetics3.html
4. GENETICS: ANALYSIS & PRINCIPLES, FOURTH EDITION, page 336
5. Fundamentals of  Biochemistry, fourth edition, page 45



Last edited by Admin on Sat Dec 09, 2017 7:58 am; edited 19 times in total

View user profile http://elshamah.heavenforum.com

9 Ribosome structure and assembly on Wed Dec 06, 2017 1:50 pm

Admin


Admin
Messenger RNA is translated in the Ribosome to make proteins
How the information in DNA specifies the production of proteins was a complete mystery in the 1950s when the double-stranded structure of DNA was first revealed as the basis of heredity. But in the intervening years, scientists discovered the complex mechanisms involved. The translation of genetic information from the 4-letter alphabet of polynucleotides into the 20-letter alphabet of proteins is done by the Ribosome. The rules of this translation seem in some respects neat and rational but in other respects strangely arbitrary, given that they are (with minor exceptions) identical in all living things. These arbitrary features have not found a better explanation as a "frozen accident". It turns out that the information in the sequence of a messenger RNA molecule is read out in groups of three nucleotides at a time: each triplet of nucleotides, or codon, specifies (codes for) a single amino acid in a corresponding protein. Since the number of distinct triplets that can be formed from four nucleotides is 43, there are 64 possible codons, all of which occur in nature. However, there are only 20 naturally occurring amino acids. That means there are necessarily many cases in which several codons correspond to the same amino acid. This genetic code is read out by a special class of small RNA molecules, the transfer RNAs (tRNAs).

Each Protein Is Encoded by a Specific Gene
DNA molecules are normally very large, specifying thousands of proteins. Special sequences of start and stop codons in the DNA serve to define where the instructions to make each protein starts and ends. And individual segments of the long DNA sequence are transcribed into separate mRNA molecules, coding for a variety of proteins. Each such DNA segment represents one gene. A remarkable fact is that RNA molecules transcribed from the same DNA segment can often be spliced by a molecular machine named spliceosome, and expressed in more than one way, so as to give rise to a set of different versions of proteins, especially in more complex eukaryotic cells. In addition, some DNA segments—a smaller number— commonly held as Junk DNA, are transcribed into RNA molecules that are not translated but have catalytic, regulatory, or structural functions; such DNA segments also count as genes. A gene, therefore, is defined as the segment of DNA sequence corresponding to a single protein or set of alternative protein variants or to a single catalytic, regulatory, or structural RNA molecule. In all cells, the expression of individual genes is regulated: instead of manufacturing its full repertoire of possible proteins at full tilt all the time, the cell adjusts the rate of transcription and translation of different genes independently, according to need. Stretches of regulatory DNA are interspersed among the segments that code for protein, and these noncoding regions bind to special protein molecules that control the local rate of transcription. The quantity and organization of the regulatory DNA vary widely from one class of organisms to another, but the basic strategy is universal. In this way, the genome of the cell—that is, the totality of its genetic information as embodied in its complete DNA sequence— dictates not only the nature of the cell’s proteins, but also when and where they are to be made.



How is the code translated?

One can think of the sequence of bases on mRNA as a series of code letters that are read as a series of three-letter "words." 3

For example, if mRNA had a sequence of bases such as

"...AUGAAGCCGAGUUAAGAU...."

This sequence would, in effect, be read as a series of three-letter words referred to as "codons", each of which specified the insertion of a specific amino acid. In the example just above, the codons or "words" would be:

"...AUG-AAG-CCG-AGU-UAA-GAU...."

Each of these three letter words specifies the insertion of one of the 20 amino acids that make up proteins. The amino acids are shuttled to the ribosome by a family of transfer RNAs (tRNA), and there are specific tRNAs for each amino acid. The tRNAs consist of a single strand of RNA, but the strand tends to fold back on itself and create loops that are held in place by hydrogen bonds between segments of the tRNA as shown in the illustration below.



In the illustration above the base sequence CAT on DNA was transcribed to become the codon GUA on messenger RNA. The mRNA left the nucleus and attached to a ribosome where protein synthesis (translation) was initiated. Each codon on mRNA specified a particular amino acid to be added to the growing protein chain. In this example, the first four amino acids are designated as "AA1-AA2-AA3-AA4". The next codon on mRNA was "GUA." The complement to GUA is "CAU" which is the anticodon on a transfer RNA that carries the amino acid valine. The anticodon CAU on the tRNA for valine bonded to the GUA codon on mRNA. This positioned valine as the next amino acid in sequence, and with the addition of cellular energy (ATP), valine became covalently bonded to AA4 in the amino acid chain.

In the section above on transcription, we focused on creating the mRNA for a specific gene; those events took place in the cell nucleus. The figure below illustrates the subsequent events that take place after mRNA leaves the nucleus and attaches to a ribosome and initiates translation.



Sixty-one codons specify an amino acid, and the remaining three act as stop signals for protein synthesis. For example, the codon UGA signals an end to synthesis of the protein. The code for all possible three-letter codons on mRNA is shown in the blue table below. Note that there is some redundancy in the code. For example, there are four separate codons for the amino acid proline. Nevertheless, the code is unambiguous, because no triplet codes for more than one amino acid. In addition, with only a few minor exceptions, the same code is universally found in viruses, bacteria, protists, plants, fungi, and animals. Note that in the example below, UGA, is a signal to STOP, meaning that the amino acid chain is complete and no more amino acids are to be added. Bear in mind that these illustrations include just short sequences of codons, and an actual protein would generally have a much longer sequence. Nevertheless, these examples illustrated how the code is transcribed from DNA to mRNA and how the mRNA is then translated in order to specify the sequence of amino acids in a particular protein which is the product of that particular gene on a chromosome.



Each type of tRNA becomes attached at one end to a specific amino acid, and displays at its other end a specific sequence of three nucleotides—an anticodon— that enables it to recognize, through base-pairing, a particular codon or subset of codons in mRNA. The intricate chemistry that enables these tRNAs to translate a specific sequence of A, C, G, and U nucleotides in a mRNA molecule into a specific sequence of amino acids in a protein molecule occurs on the ribosome, a large multimolecular machine composed of both protein and ribosomal RNA.

During translation, the Genetic Code within mRNA is used to make a Polypeptide with a Specific Amino Acid sequence 
Why have researchers named this process translation? At the molecular level, translation involves an interpretation of one language—the language of mRNA, a nucleotide sequence—into the language of proteins—an amino acid sequence. The ability of mRNA to be translated into a specific sequence of amino acids relies on the genetic code. The sequence of bases within an mRNA molecule provides coded information that is read in groups of three nucleotides known as codons. 


The relationships among the DNA coding sequence, mRNA codons, tRNA anticodons, and amino acids in a polypeptide. The sequence of nucleotides within DNA is transcribed to make a complementary sequence of nucleotides within mRNA. This sequence of nucleotides in mRNA is translated into a sequence of amino acids of a polypeptide. tRNA molecules act as intermediates in this translation process.

The sequence of three bases in most codons specifies a particular amino acid. These codons are termed sense codons. For example, the codon AGC specifies the amino acid serine, whereas the codon GGG encodes the amino acid glycine. The codon AUG, which specifies methionine, is used as a start codon; it is usually the first codon that begins a polypeptide sequence. The AUG codon can also be used to specify additional methionines within the coding sequence. Finally, three codons are used to end the process of translation. These are UAA, UAG, and UGA, which are known as stop codons. They are also known as termination or nonsense codons. The codons in mRNA are recognized by the anticodons in transfer RNA (tRNA) molecules (see Figure 13.3). Anticodons are three-nucleotide sequences that are complementary to codons in mRNA. The tRNA molecules carry the amino acids that correspond
to the codons in the mRNA. In this way, the order of codons in mRNA dictates the order of amino acids within a polypeptide. The details of the genetic code are shown below .


Because polypeptides are composed of 20 different kinds of amino acids, a minimum of 20 codons is needed in order to specify each type. With four types of bases in mRNA (A, U, G, and C), a genetic code containing two bases in a codon would not be sufficient because it would only have 42, or 16, possible types. By comparison, a three-base codon system can specify 43, or 64, different codons. Because the number of possible codons exceeds 20—which is the number of different types of amino acids—the genetic code is termed degenerate . This means that more than one codon can specify the same amino acid. For example, the codons GGU, GGC, GGA, and GGG all specify the amino acid glycine. Such codons are termed synonymous codons. In most instances, the third base in the codon is the base that varies. The third base is sometimes referred to as the wobble base. This term is derived from the idea that the complementary base in the tRNA can “wobble” a bit during the recognition of the third base of the codon in mRNA. The start codon (AUG) defines the reading frame of an mRNA—a sequence of codons determined by reading bases in groups of three, beginning with the start codon. This concept is best understood with a few examples. 

The mRNA sequence shown below encodes a short polypeptide with 7 amino acids:

5ʹ–AUGCCCGGAGGCACCGUCCAAU–3ʹ
Met–Pro–Gly–Gly–Thr–Val–Gln

If we remove one base (C) adjacent to the start codon, this changes the reading frame to produce a different polypeptide sequence:
5ʹ–AUGCCGGAGGCACCGUCCAAU–3ʹ
Met–Pro–Glu–Ala–Pro–Ser–Asn

Alternatively, if we remove three bases (CCC) next to the start codon, the resulting polypeptide has the same reading frame as the first polypeptide, though one amino acid (Pro, proline) has been deleted:

5ʹ–AUGGGAGGCACCGUCCAAU–3ʹ
Met–Gly–Gly–Thr–Va l – G l n

Polypeptide synthesis has a directionality that parallels the order of codons in the mRNA. As a polypeptide is made, a peptide bond is formed between the carboxyl group in the last amino acid of the polypeptide chain and the amino group in the amino acid being added. As shown in the  Figure below, this occurs via a condensation reaction that releases a water molecule. 


The directionality of polypeptide synthesis
(a) An amino acid is connected to a polypeptide chain via a condensation reaction that releases a water molecule. The letter R is a general designation for an amino acid side chain. 
(b) The first amino acid in a polypeptide chain (usually methionine) is located at the amino-terminal end, and the last amino acid is at the carboxyl-terminal end. Thus, the directionality of amino acids in a polypeptide chain is from
the amino terminal-end to the carboxyl-terminal end, which corresponds to the 5ʹ to 3ʹ orientation of codons in mRNA.

The newest amino acid added to a growing polypeptide always has a free carboxyl group. b in the Figure above compares the sequence of a very short polypeptide with the mRNA that encodes it. The first amino acid is said to be at the N-terminus, or amino-terminal end, of the polypeptide. An amino group (NH3+) is found at this site. The term N-terminus refers to the presence of a nitrogen atom (N) at this end. The first amino acid is specified by a codon that is near the 5ʹ end of the mRNA. By comparison, the last amino acid in a completed polypeptide is located at the C-terminus or carboxyl-terminal end. A carboxyl group (COO–) is always found at this site in the polypeptide chain. This last amino acid is specified by a codon that is closer to the 3ʹ end of the mRNA.

What Are the Structures and Properties of Amino Acids?

Typical Amino Acids Contain a Central Tetrahedral Carbon Atom
The structure of a single typical amino acid is shown in Figure below. 



Anatomy of an amino acid. Except for proline and its derivatives, all of the amino acids commonly found in proteins possess this type of structure.

Central to this structure is the tetrahedral alpha (a) carbon (Ca), which is covalently linked to both the amino group and the carboxyl group. Also bonded to this a-carbon are a hydrogen and a variable side chain. It is the side chain, the so-called R group, that gives each amino acid its identity. It is sufficient for now to realize that in neutral solution (pH 7), the carboxyl group exists as OCOO2 and the amino group as ONH3. Because the resulting amino acid contains one positive and one negative charge, it is a neutral molecule called a zwitterion. Amino acids are also chiral molecules. With four different groups attached to it, the a-carbon is said to be asymmetric.  The two possible configurations for the a-carbon constitute nonidentical mirrorimage isomers or enantiomers.

Amino Acids Can Join via Peptide Bonds
The crucial feature of amino acids that allows them to polymerize to form peptides and proteins is the existence of their two identifying chemical groups: the amino (ONH31) and carboxyl (OCOO2) groups, as shown in Figure below:


Anatomy of an amino acid. Except for proline and its derivatives, all of the amino acids commonly found in proteins possess this type of structure.

The amino and carboxyl groups of amino acids can react in a head-to-tail fashion, eliminating a water molecule and forming a covalent amide linkage, which, in the case of peptides and proteins, is typically referred to as a peptide bond. The equilibrium for this reaction in aqueous solution favors peptide bond hydrolysis. For this reason, biological systems, as well as peptide chemists in the laboratory, must couple peptide bond formation in an indirect manner or with energy input. Repetition of the reaction shown in above Figure produces polypeptides and proteins. The remarkable properties of proteins all depend in one way or another on the unique properties and chemical diversity of the 20 common amino acids found in proteins.

The amino acid sequences of polypeptides determine the structure and function of Proteins
The Figure below shows the 20 different amino acids that may be found within polypeptides.



The amino acids that are incorporated into polypeptides during translation. 
Parts (a) through (e) show the 20 standard amino acids, and part (f) shows two amino acids that are occasionally incorporated into polypeptides by the use of stop codons
The structures of amino acid side chains can also be covalently modified after a polypeptide is made, a phenomenon called post-translational modification.

Proteins
Proteins are polymers found in all cells and play critical roles in nearly all life processes. The word protein comes from the Greek proteios (meaning of the first rank), which aptly describes their importance. Proteins account for about 50% of the organic material in a typical animal’s body.



Each amino acid contains a unique side chain, or R group, that has its own particular chemical properties. For example, aliphatic and aromatic amino acids are relatively nonpolar, which means they are less likely to associate with water. These hydrophobic (meaning water-fearing) amino acids are often buried within the interior of a folded protein. In contrast, the polar amino acids are hydrophilic (water-loving) and are more likely to be on the surface of a protein, where they can favorably interact with the surrounding water. The chemical properties of the amino acids and their sequences. in a polypeptide are critical factors that determine the unique structure of that polypeptide.
Following gene transcription and mRNA translation, the end result is a polypeptide with a defined amino acid sequence. This sequence is the primary structure of a polypeptide. The Figure  shows the primary structure of an enzyme called lysozyme, a relatively small protein containing 129 amino acids.


An example of a protein’s primary structure.
This is the amino acid sequence of the enzyme lysozyme, which contains 129 amino acids in its primary structure. As you may have noticed, the first amino acid is not methionine; instead, it is lysine. The first methionine residue in this polypeptide sequence is removed after or during translation. The removal of the first methionine occurs in many (but not all) proteins.

The individual polypeptides are called subunits of the protein, each of which has its own tertiary structure. The association of multiple subunits is the quaternary structure of a protein.

Amino acids are joined together by a dehydration reaction that links the carboxyl group of one amino acid to the amino group of another ( Figure below a ) :



The chemistry of polypeptide formation.
Polypeptides are polymers of amino acids. They are formed by linking amino acids via dehydration reactions to make peptide bonds. Every polypeptide has an amino end, or N-terminus, and a carboxyl end, or C-terminus.

The primary structure of a typical polypeptide may be a few hundred or even a couple of thousand amino acids in length. Within a living cell, a newly made polypeptide is not usually found in a long linear state for a significant length of time. Rather, to become a functional unit, most polypeptides quickly adopt a compact three-dimensional structure. The folding process begins while the polypeptide is still being translated. The progression from the primary structure of a polypeptide to the three-dimensional structure of a protein is dictated by the amino acid sequence within the polypeptide. In particular, the chemical properties of the amino acid side chains play a central role in determining the folding pattern of a protein. In addition, the folding of some polypeptides is aided by chaperones—proteins that bind to polypeptides and facilitate their proper folding. This folding process of polypeptides is governed by the primary structure and occurs in multiple stages (Figure below ). 



The first stage involves the formation of a regular, repeating shape known as a secondary structure. The two types of secondary structures are the α helix and the β sheet (Figure b above). A single polypeptide may have some regions that fold into an α helix and other regions that fold into a β sheet. Because of the geometry of secondary structures, certain amino acids, such as glutamic acid, alanine, and methionine, are good candidates to form an α helix. Other amino acids, such as valine, isoleucine, and tyrosine, are more likely to be found in a β-sheet conformation. Secondary structures within polypeptides are primarily stabilized by the formation of hydrogen bonds between atoms that are located in the polypeptide backbone. In addition, some regions do not form a repeating secondary structure. Such regions have shapes that look very irregular in their structure because they do not follow a repeating folding pattern. The short regions of secondary structure within a polypeptide are folded relative to each other to make the tertiary structure of a polypeptide. As shown in Figure c, α-helical regions and β-sheet regions are connected by irregularly shaped segments to determine the tertiary structure of the polypeptide.

The folding of a polypeptide into its secondary and then tertiary conformation can usually occur spontaneously because it is a thermodynamically favorable process. The structure is determined by various interactions, including the tendency of hydrophobic amino acids to avoid water, ionic interactions among charged amino acids, hydrogen bonding among amino acids in the folded polypeptide, and weak bonding known as van der Waals interactions. A protein is a functional unit that can be composed of one or more polypeptides. Some proteins are composed of a single polypeptide. Many proteins, however, are composed of two or more polypeptides that associate with each other to make a functional protein with a quaternary structure (Figure d). 

Five factors are critical for protein folding and stability
1. Hydrogen bonds
The large number of weak hydrogen bonds within a polypeptide and between polypeptides adds up to a collectively strong force that promotes protein folding and stability. As we have already learned, hydrogen
bonding is a critical determinant of protein secondary structure and also is important in tertiary and quaternary
structure.
2. Ionic bonds and other polar interactions
Some amino acid side chains are positively or negatively charged. Positively charged side chains may bind to negatively charged side chains via ionic bonds. Similarly, uncharged polar side chains in a protein may bind to ionic amino acids. Ionic bonds and polar interactions are particularly important in tertiary and quaternary structure.
3. Hydrophobic effect
Some amino acid side chains are nonpolar. These amino acids tend to exclude water. As a protein folds, the hydrophobic amino acids are likely to be found in the center of the protein, minimizing contact
with water. As mentioned, some proteins have stretches of nonpolar amino acids that anchor them in the hydrophobic portion of membranes. The hydrophobic effect plays a major role in tertiary and quaternary structures.
4. van der Waals forces
Atoms within molecules have weakattractions for each other if they are an optimal distance apart. This optimal distance is called the van der Waals radius, and the weak attraction is the van der Waals force. If two atoms are very close together, their electron clouds will repel each other. If they are far apart,the van der Waals force will diminish. The van der Waals forces are particularly important for tertiary structure.
5. Disulfide bridges
The side chain of the amino acid cysteine contains a sulfhydryl group (—SH), which can react with a sulfhydryl group in another cysteine side chain. The result is a disulfide bridge or bond, which links the two amino acid side chains together (—S—S—). Disulfide bonds are covalent bonds that can occur within a polypeptide or between different polypeptides. Though other forces are usually more important in protein folding, the covalent nature of disulfide bonds can help to stabilize the tertiary structure of a protein.


Factors that influence protein folding and stability

The first four factors just described are also important in the ability of different proteins to interact with each other. Many cellular processes involve steps in which two or more different proteins interact with each other. For this to occur, the surface of one protein must bind to the surface of the other. Such binding is usually very specific. The surface of one protein precisely fits into the surface of another . Such protein-protein interactions are critically important so that cellular processes can occur in a series of defined steps. In addition, protein-protein interactions are important in building cellular structures that provide shape and organization to cells.

The Defining Concept of Biochemistry Is “Molecular Recognition Through Structural Complementarity”
Structural complementarity is the means of recognition in biomolecular interactions. The complicated and highly organized patterns of life depend on the ability of biomolecules to recognize and interact with one another in very specific ways. Such interactions are fundamental to metabolism, growth, replication, and other vital processes. The interaction of one molecule with another, a protein with a metabolite, for example, can be most precise if the structure of one is complementary to the structure of the other, as in two connecting pieces of a puzzle or, in the more popular analogy for macromolecules and their b ligands, a lock and its key. This principle of structural complementarity is the very essence of biomolecular recognition. Structural complementarity is the significant clue to understanding the functional properties of biological systems. Biological systems, from the macromolecular level to the cellular level, operate via specific molecular recognition mechanisms based on structural complementarity: A protein recognizes its specific metabolite, an antibody recognizes its antigen, a strand of DNA recognizes its complementary strand, sperm recognize an egg. All these interactions involve structural complementarity between molecules. 1

It's remarkable how the author does not avoid teleology in his explanation. Recognizing something depends on volition, which biomolecules definitively lack. The principle of structural complementation extends in ALL molecular biology and is a core reason why the origin of proteins based on non-intelligent causal mechanisms is far too unspecific, besides being the very core of Behe's argument of irreducible complexity: Most proteins depend on multiple interlocked and interdependent subunits, structurally and by form fine-tuned and adapted to each other, which work in a coordinated manner together, provoking conformational changes and a vast array of different reactions. One subunit has no function in absence of the other, in the same manner as a lock has no function without the key. Recognition of the other subunit(s) must be pre-visualized, thought of, invented, and implemented accordingly. And that all depends on intelligence......




Proteins contain functional domains within their structures
Modern research into the functions of proteins has revealed that many proteins have a modular design. This means that portions within proteins, called modules, motifs, or domains, have distinct structures and functions. These units of amino acid sequences have been duplicated during evolution so that the same kind of domain may be found in several different proteins. When the same domain is found in different proteins, the domain has the same three-dimensional shape and performs a function that is characteristic of that domain. As an example, Figure below shows a member of a family of related proteins that are known to play critical roles in regulating how certain genes are turned on and off in living cells. 


The domain structure of a STAT protein

This protein bears the cumbersome name of signal transducer and activator of transcription (STAT) protein. Each domain of this protein is involved in a distinct biological function, a common occurrence in proteins with multiple domains. For example, one of the domains is labeled the SH2 domain (Figure above). Many different proteins contain this domain. It allows such proteins to recognize other proteins in a very specific way. The function of SH2 domains is to bind to tyrosine amino acids to which phosphate groups have been added by cellular enzymes. When an amino acid receives a phosphate group in this way, it is said to be phosphorylated (as is the protein in which the tyrosine exists). As might be predicted, proteins that contain SH2 domains all bind to phosphorylated tyrosines in the proteins they recognize. As a second example, a STAT protein has another domain called a DNA-binding domain. This portion of the protein has a structure that specifically binds to DNA. Overall, the domain structure of proteins enables them to have multiple, discrete regions, each with its own structure and purpose in the functioning of the protein.


Cellular Proteins are primarily responsible for the characteristics of living cells and an organism’s traits
Why is the genetic material largely devoted to storing the information to make proteins? To a great extent, the characteristics of a cell depend on the types of proteins that it makes. In turn, the traits of multicellular organisms are determined by the properties of their cells. Proteins perform a variety of functions critical to the life of cells and to the morphology and function of organisms. Some proteins are important in determining the shape and structure of a given cell. For example, the protein tubulin assembles into large cytoskeletal structures known as microtubules, which provide eukaryotic cells with internal structure and organization. Some proteins are inserted into the cell membrane and aid in the transport of ions and small molecules across the membrane. An example is a sodium channel that transports sodium ions into nerve cells. Another interesting category of proteins are those that function as biological motors, such as myosin, which is involved in the contractile properties of muscle cells. Within multicellular organisms, certain proteins function in cell signaling and cell surface recognition. For example, proteins, such as the hormone insulin, are secreted by endocrine cells and bind to the insulin receptor proteins found within the plasma membrane of target cells.

Many proteins are enzymes, which function to accelerate chemical reactions within the cell. Some enzymes assist in the breakdown of molecules or macromolecules into smaller units. These are known as catabolic enzymes and are important in utilizing cellular energy. In contrast, anabolic enzymes function in the synthesis of molecules and macromolecules. Throughout the cell, the synthesis of molecules and macromolecules relies on enzymes and accessory proteins. Ultimately, then, the construction of a cell greatly depends on its anabolic enzymes because these are required to synthesize all cellular macromolecules.

Ribosome structure and assembly
The ribosome can be thought of as the macromolecular arena where translation takes place. Bacterial cells have one type of ribosome that is found within the cytoplasm. Eukaryotic cells contain biochemically distinct ribosomes
in different cellular locations. The most abundant type of ribosome functions in the cytosol, which is the region of the eukaryotic cell that is inside the plasma membrane but outside the membrane-bound organelles. Besides the cytosolic ribosomes, all eukaryotic cells have ribosomes within the mitochondria. In addition, plant cells and algae have ribosomes in their chloroplasts. The compositions of mitochondrial and chloroplast ribosomes are quite different from that of the cytosolic ribosomes. Each ribosome is composed of structures called the large and small subunits. This term is perhaps misleading because each ribosomal subunit itself is formed from the assembly of many different proteins and RNA molecules called ribosomal RNA or rRNA. In bacterial ribosomes, the 30S subunit is formed from the assembly of 21 different ribosomal proteins and a 16S rRNA molecule; the 50S subunit contains 34 different proteins and 5S and 23S rRNA molecules (Table below ).



Together, the 30S and 50S subunits form a 70S ribosome.  In bacteria, the ribosomal proteins and rRNA molecules are synthesized in the cytoplasm, and the ribosomal subunits are assembled there. The synthesis of eukaryotic rRNA occurs within the nucleus, and the ribosomal proteins are made in the cytosol, where translation takes place. The 40S subunit is composed of 33 proteins and an 18S rRNA; the 60S subunit is made of 49 proteins and 5S, 5.8S, and 28S rRNAs. The assembly of the rRNAs and ribosomal proteins to make the 40S and 60S subunits occurs within the nucleolus, a region of the nucleus specialized for this purpose. The 40S and 60S subunits are then exported into the cytosol, where they associate to form an 80S ribosome during translation.

Components of ribosomal subunits form functional sites for translation
To understand the structure and function of the ribosome at the molecular level, researchers must determine the locations and functional roles of the individual ribosomal proteins and rRNAs. In recent years, many advances have been made toward a molecular understanding of ribosomes. Microscopic and biophysical methods have been used to study ribosome structure. An electron micrograph of bacterial ribosomes is shown in Figure a, below.


Ribosomal structure 
(a) Electron micrograph of ribosomes attached to a bacterial mRNA molecule. 
(b) Crystal structure of the 50S and 30S subunits in bacteria. This model shows the interface between the two subunits. The rRNA is shown in gray strands (50S subunit) and turquoise strands (30S subunit), and proteins are
shown in violet (50S subunit) and navy blue (30S subunit). 
(c) A model depicting the sites where tRNA and mRNA bind to an intact ribosome. The mRNA lies on the surface of the 30S subunit. The E, P, and A sites are formed at the interface between the large and small subunits. The
growing polypeptide chain exits through a hole in the 50S subunit

More recently, a few research groups have succeeded in crystallizing ribosomal subunits, and even intact ribosomes. This is an amazing technical feat, because it is difficult to find the right conditions under which large macromolecules will form highly ordered crystals. Figure b shows the crystal structure of bacterial ribosomal subunits. The overall shape of each subunit is largely determined by the structure of the rRNAs, which constitute most of the mass of the ribosome. The interface between the 30S and 50S subunits is primarily composed of rRNA. Ribosomal proteins cluster on the outer surface of the ribosome and on the periphery of the interface. During bacterial translation, the mRNA lies on the surface of the 30S subunit within a space between the 30S and 50S subunits. As the polypeptide is being synthesized, it exits through a channel within the 50S subunit (Figure c). Ribosomes contain discrete sites where tRNAs bind and the polypeptide is synthesized. In 1964, James Watson was the first to propose a two-site model for tRNA binding to the ribosome. These sites are known as the peptidyl site (P site) and aminoacyl site (A site). In 1981, Knud Nierhaus, Hans Sternbach, and Hans-J örg Rheinberger proposed a three-site model. This model incorporated the observation that uncharged tRNA molecules can bind to a site on the ribosome that is distinct from the P and A sites. This third site is now known as the exit site (E site). The locations of the E, P, and A sites are shown in Figure c. Next, we will examine the roles of these sites during the three stages of translation.

Structure and function of tRNA
Biochemical studies of protein synthesis and tRNA molecules began in the 1950s. As work progressed toward an understanding of translation, research revealed that different kinds of RNA molecules are involved in the incorporation of amino acids into growing polypeptides. Francis Crick proposed the adaptor hypothesis. According to this idea, the position of an amino acid within a polypeptide chain is determined by the binding between the mRNA and an adaptor molecule carrying a specific amino acid. Later, work by Paul Zamecnik and Mahlon Hoagland suggested that the adaptor molecule is tRNA. During translation, a tRNA has two functions: 

(1) It recognizes a three-base codon sequence in mRNA, and 
(2) it carries an amino acid specific for that codon. 

The function of a tRNA depends on the specificity between the amino acid it carries and its anticodon
The adaptor hypothesis proposes that tRNA molecules recognize the codons within mRNA and carry the correct amino acids to the site of polypeptide synthesis. During mRNA-tRNA recognition, the anticodon in a tRNA molecule binds to a codon in mRNA due to their complementary sequences ( See figure below ) 


Recognition between tRNAs and mRNA. 
The anticodon in the tRNA binds to a complementary sequence in the mRNA. At its other end, the tRNA carries the amino acid that corresponds to the codon in the mRNA via the genetic code.

Importantly, the anticodon in the tRNA corresponds to the amino acid that it carries. For example, if the anticodon in the tRNA is 3ʹ–AAG–5ʹ, it is complementary to a 5ʹ–UUC–3ʹ codon. According to the genetic code, described earlier in this chapter, the UUC codon specifies phenylalanine. Therefore, the tRNA with a 3ʹ–AAG–5ʹ anticodon must carry a phenylalanine. As another example, if the tRNA has a 3ʹ–GGC–5ʹ anticodon, it is complementary to a 5ʹ–CCG–3ʹ codon that specifies proline. This tRNA must carry proline. Recall that the genetic code has 64 codons. Of these, 61 are sense codons that specify the 20 amino acids. Therefore, to synthesize proteins, a cell must produce many different tRNA molecules having specific anticodon sequences. To do so, the chromosomal DNA contains many distinct tRNA genes that encode tRNA molecules with different sequences. According to the adaptor hypothesis, the anticodon in a tRNA specifies the type of amino acid that it carries. Due to this specificity, tRNA molecules are named according to the type of amino acid they carry. For example, a tRNA that attaches to phenylalanine is described as tRNAPhe, whereas a tRNA that carries proline is tRNAPro.

Common structural features are shared by all tRNAs
To understand how tRNAs act as carriers of the correct amino acids during translation, researchers have examined the structural characteristics of these molecules in great detail. Though a cell makes many different tRNAs, all tRNAs share common structural features. As originally proposed by Robert W. Holley in 1965, the secondary structure of tRNAs exhibits a cloverleaf pattern. A tRNA has three stem-loop structures, a few variable sites, and an acceptor stem with a 3ʹ single-stranded region (Figure below ).


Secondary structure of tRNA
The conventional numbering of nucleotides begins at the 5ʹ end and proceeds toward the 3ʹ end. In all tRNAs, the nucleotides at the 3ʹ end contain the sequence CCA. Certain locations can have additional nucleotides not found in all tRNA molecules. These variable sites are shown in blue. The figure also shows the locations of a few modified bases specifically found in a yeast tRNA that carries alanine. The modified bases are as follows:  I = inosine, mI = methylinosine, T = ribothymidine, UH2 = dihydrouridine, m2G = dimethylguanosine, and P = pseudouridine. The inset shows an amino acid covalently attached to the 3ʹ end of a tRNA.

The acceptor stem is where an amino acid becomes attached to a tRNA (see inset). A conventional numbering system for the nucleotides within a tRNA molecule begins at the 5ʹ end and proceeds toward the 3ʹ end. Among different types of tRNA molecules, the variable sites (shown in blue) can differ in the number of nucleotides they contain. The anticodon is located in the second loop region. The actual three-dimensional, or tertiary, structure of tRNA molecules involves additional folding of the secondary structure. In the tertiary structure of tRNA, the stem-loop regions are folded into a much more compact molecule. Interestingly, in addition to the normal A, U, G, and C nucleotides, tRNA molecules commonly contain modified nucleotides within their primary structures. For example, Figure above illustrates a tRNA that contains several modified bases. Among many different species, researchers have found that more than 80 different nucleotide modifications can occur in tRNA molecules. 

Aminoacyl-tRNA Synthetases charge tRNAs by attaching the appropriate amino acid
To function correctly, each type of tRNA must have the appropriate amino acid attached to its 3ʹ end. How does an amino acid get attached to a tRNA with the correct anticodon? Enzymes in the cell known as aminoacyl-tRNA synthetases catalyze the attachment of amino acids to tRNA molecules. Cells produce 20 different aminoacyl-tRNA synthetase enzymes, 1 for each of the 20 distinct amino acids. Each aminoacyl-tRNA synthetase is named for the specific amino acid it attaches to tRNA. For example, alanyl-tRNA synthetase recognizes a tRNA with an alanine anticodon—tRNAAla—and attaches an alanine to it. Aminoacyl-tRNA synthetases catalyze a chemical reaction involving three different molecules: an amino acid, a tRNA molecule, and ATP. In the first step of the reaction, a synthetase recognizes a specific amino acid and also ATP (Figure below )

Catalytic function of aminoacyltRNA synthetase 
Aminoacyl-tRNA synthetase has binding sites for a specific amino acid, ATP, and a particular tRNA. In the first step, the enzyme catalyzes the covalent attachment of AMP to an amino acid, yielding an activated amino acid. In the second step, the activated amino acid is attached to the appropriate tRNA.


The ATP is hydrolyzed, and AMP becomes attached to the amino acid; pyrophosphate is released. During the second step, the correct tRNA binds to the synthetase. The amino acid becomes covalently attached to the 3ʹ end of the tRNA molecule at the acceptor stem, and AMP is released. Finally, the tRNA with its attached amino acid is released from the enzyme. At this stage, the tRNA is called a charged tRNA or an aminoacyl-tRNA. In a charged tRNA molecule, the amino acid is attached to the 3ʹ end of the tRNA by a covalent bond (see Figure Secondary structure of tRNA , above,  inset). The ability of the aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” This recognition process is necessary to maintain the fidelity of genetic information. The frequency of error for aminoacyl-tRNA synthetases is less than 10–5. In other words, the wrong amino acid is attached to a tRNA less than once in 100,000 times! As you might expect, the anticodon region of the tRNA is usually important for precise recognition by the correct aminoacyl-tRNA synthetase. In studies of Escherichia coli synthetases, 17 of the 20 types of aminoacyl-tRNA synthetases recognize the anticodon region of the tRNA. However, other regions of the tRNA are also important recognition sites. These include the acceptor stem and bases in the stem-loop regions. As mentioned previously, tRNA molecules frequently contain bases within their structure that have been chemically modified. These modified bases can have important effects on tRNA function. For example, modified bases within tRNA molecules affect the rate of translation and the recognition of tRNAs by aminoacyl-tRNA synthetases. Positions 34 and 37 contain the largest variety of modified nucleotides; position 34 is the first base in the anticodon that matches the third base in the codon of mRNA. As discussed next, a modified base at position 34 can have important effects on codon-anticodon recognition.

Mismatches that follow the wobble rule can occur at the third position in codon-anticodon pairing
After considering the structure and function of tRNA molecules, let’s reexamine some subtle features of the genetic code. As discussed earlier, the genetic code is degenerate, which means that more than one codon can specify the same amino acid. Degeneracy usually occurs at the third position in the codon. For example, valine is specified by GUU, GUC, GUA, and GUG. In all four cases, the first two bases are G and U. The third base, however, can be U, C, A, or G. To explain this pattern of degeneracy, Francis Crick proposed in 1966 that it is due to “wobble” at the third position in the codon-anticodon recognition process. According to the wobble rules, the first two positions pair strictly according to the AU/GC rule. However, the third position can tolerate certain types of mismatches (Figure below ).


Wobble position and base-pairing rules 
(a) The wobble position occurs between the first base (meaning the first base in the 5ʹ to 3ʹ direction) in the anti codon and the third base in the mRNA codon. 
(b) The revised wobble rules are slightly different from those originally proposed by Crick. The standard bases found in RNA are G, C, A, and U. In addition, the structures of bases in tRNAs may be modified. Some modified bases that may occur in the wobble position in tRNA are I = inosine; xm5s2U = 5-methyl- 2-thiouridine; xm5Um = 5-methyl-2ʹ-O-methyluridine; Um = 2ʹ-O-methyluridine; xm5U = 5 methyluridine; xo5U = 5-hydroxyuridine; k2C = lysidine (a cytosine derivative). The mRNA bases in parentheses are recognized very poorly by the tRNA.

This proposal suggested that the base at the third position in the codon does not have to hydrogen bond as precisely with the corresponding base in the anticodon. Because of the wobble rules, some flexibility is observed in the recognition between a codon and anticodon during the process of translation. When two or more tRNAs that differ at the wobble base are able to recognize the same codon, these are termed isoacceptor tRNAs. As an example, tRNAs with an anticodon of 3ʹ–CCA–5ʹ or 3ʹ–CCG–5ʹ can recognize a codon with the sequence of 5ʹ–GGU–3ʹ. In addition, the wobble rules enable a single type of tRNA to recognize more than one codon. For example, a tRNA with an anticodon sequence of 3ʹ– AAG–5ʹ can recognize a 5ʹ–UUC–3ʹ and a 5ʹ–UUU–3ʹ codon. The 5ʹ–UUC–3ʹ codon is a perfect match with this tRNA. The 5ʹ–UUU–3ʹ codon is mismatched according to the standard RNA-RNA hybridization rules (namely, G in the anticodon is mismatched to U in the codon), but the two can fit according to the wobble rules described in the Figure above. Likewise, the modification of the wobble base to an inosine allows a tRNA to recognize three different codons. At the cellular level, the ability of a single tRNA to recognize more than one codon makes it unnecessary for a cell to make 61 different tRNA molecules with anticodons that are complementary to the 61 possible sense codons. E. coli cells, for example, make a population of tRNA molecules that have just 40 different anticodon sequences.

Stages of translation 
Like transcription, the process of translation can be viewed as occurring in three stages: initiation, elongation, and termination.
The Figure below  presents an overview of these stages.



Overview of the stages of translation
The initiation stage involves the assembly of the ribosomal subunits, mRNA, and the initiator tRNA carrying the first amino acid. During elongation, the ribosome slides along the mRNA and synthesizes a polypeptide chain. Translation ends when a stop codon is reached and the polypeptide is released from the ribosome. (Note: In this and succeeding figures in this chapter, the ribosomes are drawn schematically to emphasize different aspects of the translation process. 

During initiation, the ribosomal subunits, mRNA, and the first tRNA assemble to form a complex. After the initiation complex is formed, the ribosome slides along the mRNA in the 5ʹ to 3ʹ direction, moving over the codons. This is the elongation stage of translation. As the ribosome moves, tRNA molecules sequentially bind to the mRNA at the A site in the ribosome, bringing with them the appropriate amino acids. Therefore, amino acids are linked in the order dictated by the codon sequence in the mRNA. Finally, a stop codon is reached, signaling the termination of translation. At this point, disassembly occurs, and the newly made polypeptide is released. In this section, we will examine the components required for the translation process and consider their functional roles during the three stages of translation.

1. Reginald H. Garrett, Biochemistry, 6th edition

View user profile http://elshamah.heavenforum.com

10 The Cell on Fri Dec 08, 2017 9:21 pm

Admin


Admin
The Cell

Some History
The first person to use the term cell was Robert Hooke (1635–1703) of England. He used a simple kind of microscope to study thin slices of cork from the bark of a cork oak tree. 



He saw many cubicles fitting neatly together, which reminded him of the barren rooms (cells) in a monastery. He used the term cell when he described his observations in 1665 in the publication Micrographia , the first picture book of science to come off the press, with 38 beautiful engravings. The book became a best-seller. The tiny cork boxes Hooke saw, and described in his book were, in fact, only the cell walls that surrounded the once living portions of these plant cells. We now know that the cell wall of a plant cell is produced on the outside of the cell and is composed of the complex carbohydrate called cellulose. It provides strength and protection to the living contents of the cell. Although the cell wall appears to be a rigid, solid layer of material, it is actually composed of many interwoven strands of cellulose molecules.





Hooke’s Observations
The concept of a cell has changed considerably over the past 300 years. Robert Hooke’s idea of a cell was based on his observation of slices of cork (cell walls of the bark of the cork oak tree). Hooke constructed his own simple microscope to be able to make these observations.

Thus, most kinds of molecules pass easily through it. Anton van Leeuwenhoek (1632–1723), a Dutch merchant who sold cloth, was one of the first individuals to carefully study magnified cells. He apparently saw a copy of Hooke’s Micrographia and began to make his own microscopes, so that he could study biological specimens. He was interested in magnifying glasses, because magnifiers were used to count the number of threads in cloth. He used a very simple kind of microscope that had only one lens. Basically, it was a very powerful magnifying glass. 



What made his microscope better than others of the time was his ability to grind very high-quality lenses. He used his skill at lens grinding to make about 400 lenses during his lifetime. One of his lenses was able to magnify 270 times. Van Leeuwenhoek made thousands of observations of many kinds of microscopic objects. He also made very detailed sketches of the things he viewed with his simple microscopes and communicated his findings to Robert Hooke and the Royal Society of London. His work stimulated further investigation of magnification techniques and descriptions of cell structures. When van Leeuwenhoek discovered that he could see things moving in pond water using his microscope, his curiosity stimulated him to look at a variety of other things. He studied many things such as blood, semen, feces, and pepper, for example. He was the first to see individual cells and recognize
them as living units, but he did not call them cells. The name he gave to the “little animals” he saw moving around in the pond water was animicules.

The idea that organisms are composed of cells originated in the mid-1800s. German botanist Matthias Schleiden studied plant material under the microscope and was struck by the presence of many similar-looking compartments, each of which contained a dark area. Today we call those compartments cells and the dark area the nucleus. In 1838, Schleiden speculated that cells are living entities and that plants are aggregates of cells arranged according to definite laws. Schleiden was a good friend of the German physiologist Theodor Schwann. Over dinner one evening, their conversation turned to the nuclei of plant cells, and Schwann remembered having seen similar structures in animal tissue. Schwann conducted additional studies that showed animal tissue contains large numbers of nuclei that are located in cell-like compartments and occur at regular intervals. In 1839, Schwann extended Schleiden’s hypothesis to animals. About two decades later, German biologist Rudolf Virchow proposed that omnis cellula e cellula, or “every cell originates from another cell.” This idea arose from his research, which showed that diseased cells divide to produce more diseased cells. The cell theory, which is credited to both Schleiden and Schwann with contributions from Virchow, has three parts.

Although Hooke, van Leeuwenhoek, and others continued to make observations, nearly 200 years passed before it was generally recognized that all living things are made of cells and that these cells can reproduce themselves. In 1838, Mathias Jakob Schleiden of Germany stated that all plants are made up of smaller cellular units. In 1839, Theodor Schwann, another German, published the idea that all animals are composed of cells. Soon after the term cell caught on, it was recognized that the cell wall of plant cells was essentially lifeless and that it was really the contents of the cell that had “life.” This living material was termed protoplasm, which means first-formed substance.
Scientists used the term protoplasm to distinguish between the living portion of the cell and the nonliving cell wall. As better microscopes were developed, people began to distinguish two different regions of protoplasm. One region, called the nucleus, appeared as a central body within a more fluid material surrounding it. Today, we know the nucleus is the part of a cell that contains the genetic information. Cytoplasm was the name given to the fluid portion of the protoplasm surrounding the nucleus. Although the term protoplasm is seldom used today, the term cytoplasm is still common. The development of special staining techniques, better light microscopes, and ultimately powerful electron microscopes revealed that the cytoplasm contains many structures, called organelles (little organs) . Further research has shown that each kind of organelle has certain functions related to its structure.

Cell biology is the study of life at the cellular level. Although cells are the simplest units of life, biologists have come to realize that they are wonderfully complex and interesting, providing information about all living things. 

1. All living organisms are composed of one or more cells.
2. Cells are the smallest units of life.
3. New cells come only from pre-existing cells by cell division.

Most cells are so small they cannot be seen with the unaided eye. However, as cell biologists have begun to unravel cell structure and function at the molecular level, the cell has emerged as a unit of incredible complexity and adaptability. In this chapter, we begin our examination of cells with an overview of their structures and functions. Later chapters in this unit will explore certain aspects of cell biology in greater detail. But first, let’s look at the
tools and techniques that allow us to observe cells.


A comparison of the sizes of various chemical and biological structures, and the resolving power of the unaided eye, light microscope, and electron microscope. 
The scale at the bottom is logarithmic to accommodate the wide range of sizes in this drawing.


Prokaryotic Cells
Based on cell structure, all forms of life can be placed into two categories called prokaryotes and eukaryotes. The term comes from the Greek pro and karyon, which means before a kernel— a reference to the kernel-like appearance of what would later be named the cell nucleus. Prokaryotic cells lack a membraneenclosed nucleus. the two categories of organisms that have prokaryotic cells are bacteria and archaea.  Bacteria are abundant throughout the world, being found in soil, water, and even our digestive tracts. Most bacterial species are not harmful to humans, and they play vital roles in ecology. Archaea are also widely found throughout the world, though they are less common than bacteria and often occupy extreme environments such as hot springs and deep-sea vents. Figure below shows a typical bacterial cell.



Structure of a typical bacterial cell. 
Prokaryotic cells, which include bacteria and archaea, lack internal compartmentalization.

The plasma membrane, which is a double layer of phospholipids and embedded proteins, forms an important barrier between the cell and its external environment. The cytoplasm is the region of the cell contained within the plasma membrane. Certain structures in the bacterial cytoplasm are visible via microscopy. These include the nucleoid (not to be confused with the eukaryotic nucleus), where the genetic material is located, and ribosomes, which are involved in polypeptide synthesis. Some bacterial structures are located outside the plasma membrane. Nearly all species of bacteria and archaea have a relatively rigid cell wall that supports and protects the plasma membrane and cytoplasm. The cell-wall composition varies widely among prokaryotic cells but commonly contains peptides and carbohydrates. The cell wall, which is relatively porous, allows most nutrients in the environment to reach the plasma membrane. Many bacteria also secrete a glycocalyx, an outer viscous covering surrounding the bacterium. The glycocalyx traps water and helps protect bacteria from drying out. Certain strains of bacteria that invade animals’ bodies produce a very thick, gelatinous glycocalyx called a capsule that may help them avoid being destroyed by the animal’s immune (defense) system or may aid in the attachment to cell surfaces. Finally, many prokaryotic cells have appendages such as pili and flagella. Pili allow cells to attach to surfaces and to each other. Flagella provide prokaryotic cells with a way to move, also called motility.

Eukaryotic Cells 
Aside from bacteria and archaea, all other species are eukaryotes (from the Greek, meaning true nucleus), which include protists, fungi, plants, and animals. Paramecia and algae are types of protists; yeasts and molds are types of fungi. Figure below illustrates the morphology of a typical animal cell.


Cells are the most basic units of life. 
A cell, such as the animal cell illustrated here, is the smallest unit that satisfies all of the characteristics of living organisms.Not every cell type will contain all the organelles, granules, and fibrous structures shown here, and other substructures can be present in some cell types. Cells also differ considerably in shape and in the prominence of various organelles and substructures. 


General structure of a plant cell. 
Plant cells lack lysosomes and centrioles. Unlike animal cells, plant cells have an outer cell wall; a large central vacuole that functions in storage and the regulation of cell volume; and chloroplasts, which carry out photosynthesis.


Subcellular organization of eukaryotic cells.
Electron micrograph of a plasma cell, a type of white blood cell that secretes antibodies, showing some of the larger organelles.

Surface area and volume are critical parameters that affect cell sizes and shapes
A  common feature of most cells is their small size. For example, most bacterial cells are about 1–10 μm in diameter, and a typical eukaryotic cell is 10–100 μm in diameter.


Relationship between cell size and the surface area/volume ratio
As cells get larger, the surface area/volume ratio gets smaller. Note: The three spheres shown here are not drawn precisely to scale.

Small size is a nearly universal characteristic of cells. In general, large organisms attain their large sizes by having more cells, not by having larger cells. For example, the various types of cells found in an elephant and a mouse are roughly the same sizes. However, an elephant has many more cells than a mouse. Why are cells usually small? One key factor is the interface between a cell and its extracellular environment, which is the plasma membrane. For cells to survive, they must import substances across their plasma membranes and export waste products. If the internal volume of a cell is large, it will require a greater amount of nutrient uptake and waste export. The rate of transport of substances across the plasma membrane, however, is limited by its surface area. Therefore, a critical issue for sustaining a cell is the surface area/volume ratio.

“Although living things occupy a three-dimensional space, their internal physiology and anatomy operate as if they were four-dimensional. Quarter-power scaling laws are perhaps as universal and as uniquely biological as the biochemical pathways of metabolism, the structure and function of the genetic code and the process of natural selection.,,, The conclusion here is inescapable, that the driving force for these invariant scaling laws cannot have been natural selection." 1

Though Jerry Fodor and Massimo Piatelli-Palmarini rightly find it inexplicable for 'random' Natural Selection to be the rational explanation for the scaling of the physiology, and anatomy, of living things to four-dimensional parameters, they do not seem to fully realize the implications this 'four dimensional scaling' of living things presents. This 4-D scaling is something we should rightly expect from a Intelligent Design perspective. This is because Intelligent Design holds that ‘higher dimensional transcendent information’ is more foundational to life, and even to the universe itself, than either matter or energy are. This higher dimensional 'expectation' for life, from a Intelligent Design perspective, is directly opposed to the expectation of the Darwinian framework, which holds that information, and indeed even the essence of life itself, is merely an 'emergent' property of the 3-D material realm. 2










The Cytosol
The cytosol (shown in yellow), is the region of a eukaryotic cell that is outside the membrane bound organelles but inside the plasma membrane. The other regions of the cell  include the interior of the nucleus (blue), the endomembrane system (purple and pink), and the semiautonomous organelles (orange and green). As in prokaryotic cells, the term cytoplasm refers to the region enclosed by the plasma membrane. This includes the cytosol and the organelles.


Compartments within (a) animal and (b) plant cells. 
The cytosol, which is outside the organelles but inside the plasma membrane, is shown in yellow. The membranes of the endomembrane system are shown in purple, and the fluid-filled interiors are pink. The peroxisome is dark purple. The interior of the nucleus is blue. Semiautonomous organelles are shown in orange (mitochondria) and green (chloroplasts).

Synthesis and breakdown of mMolecules occur in the cytosol
Metabolism is defined as the sum of the chemical reactions by which cells produce the materials and utilize the energy necessary to sustain life. Although many steps of metabolism also occur in cell organelles, the cytosol is a central coordinating region for many metabolic activities of eukaryotic cells. Metabolism often involves a series of steps called a metabolic pathway. Each step in a metabolic pathway is catalyzed by a specific enzyme—a protein that accelerates the rate of a chemical reaction.  Some pathways involve the breakdown of a molecule into smaller components, a process termed catabolism. Such pathways are needed by the cell to utilize energy and also to generate molecules that provide the building blocks to construct macromolecules. Conversely, other pathways are involved in anabolism, the synthesis of molecules and macromolecules. For example, polysaccharides are made by linking
sugar molecules. To make proteins, amino acids are covalently connected to form a polypeptide, using the information within an mRNA . Translation occurs on ribosomes, which are found in various locations in the cell. Some ribosomes may float freely in the cytosol, others are attached to the outer membrane of the nuclear envelope and endoplasmic reticulum membrane, and still others are found within the mitochondria or chloroplasts.

The Cytoskeleton
The cytoskeleton is a network of three different types of protein filaments: microtubules, intermediate filaments, and actin filaments (Table below).



Each type is constructed from many protein monomers. The cytoskeleton is a striking example of protein-protein interactions. The cytoskeleton is found primarily in the cytosol and also in the nucleus along the inner nuclear membrane. Let’s first consider the structure of cytoskeletal filaments and their roles in the construction and organization of cells. Later, we will examine how they are involved in cell movement. Microtubules Microtubules are long, hollow, cylindrical structures about 25 nm in diameter composed of protein subunits called α- and β-tubulin. The assembly of tubulin to form a microtubule results in a structure with a plus end and a minus end (see Table above). Microtubules grow only at the plus end, but can shorten at either the plus or minus end. A single microtubule can oscillate between growing and shortening phases, a phenomenon termed dynamic instability. This phenomenon is important in many cellular activities, including the sorting of chromosomes during cell division. The sites where microtubules form within a cell vary among different types of organisms. Nondividing animal cells contain a single
structure near their nucleus called the centrosome, also called a microtubule-organizing center. Within the centrosome are the centrioles, a conspicuous pair of structures arranged perpendicular to each other. In animal cells, microtubule growth typically starts at the centrosome in such a way that the minus end is anchored there. In contrast, most plant cells and many protists lack centrosomes and centrioles. Microtubules are created at many sites that are scattered throughout a plant cell. In plants, the nuclear membrane appears to function as a microtubule-organizing center. Microtubules are important for cell shape and organization. Organelles such as the Golgi apparatus are attached to microtubules. In addition, microtubules are involved in the organization and movement of chromosomes during mitosis and in the orientation of cells during cell division.

Intermediate Filaments Intermediate filaments are another class of cytoskeletal filament found in the cells of many but not all animal species. Their name is derived from the observation that they are intermediate in diameter between actin filaments and microtubules. Intermediate filament proteins bind to each other in a staggered array to form a twisted, ropelike structure with a diameter of approximately 10 nm (see Table above). They function as tension-bearing fibers that help maintain cell shape and rigidity. Intermediate filaments tend to be relatively permanent. By comparison, microtubules and actin filaments readily lengthen and shorten in cells. Several types of proteins assemble into intermediate filaments. Keratins form intermediate filaments in skin, intestinal, and kidney cells, where they are important for cell shape and mechanical strength. They are also a major constituent of hair and nails. In addition, intermediate filaments are found inside the cell nucleus. Nuclear lamins form a network of intermediate filaments that line the inner nuclear membrane and provide anchor points for the nuclear pores.

Actin Filaments  are also known as microfilaments, because they are the thinnest cytoskeletal filaments. They are long, thin fibers approximately 7 nm in diameter (see Table above). Like microtubules, actin filaments have plus and minus ends, and they are very dynamic structures in which each strand grows at the plus end by the addition of actin monomers. This assembly process produces a fiber composed of two strands of actin monomers that spiral around each other. Despite their thinness, actin filaments play a key role in cell shape and strength. Although actin filaments are dispersed throughout the cytosol, they tend to be highly concentrated near the plasma membrane. In many types of cells, actin filaments support the plasma membrane and provide shape and strength to the cell. The sides of actin filaments are often anchored to other proteins near the plasma membrane, which explains why actin filaments are typically found there. The plus ends grow toward the plasma membrane and play a key role in cell shape and movement.

Motor proteins interact with cytoskeletal filaments to promote movements
Motor proteins are a category of proteins that use ATP as a source of energy to promote various types of movements. As shown in Figure a, a motor protein consists of three domains: the head, hinge, and tail.


Motor proteins and their interactions with cytoskeletal filaments. 
The example illustrated here is the motor protein myosin (discussed in Chapter 44), which interacts with actin filaments. (a) Three-domain structure of myosin. (b) Conformational changes in a motor protein that allow it to “walk” along a cytoskeletal filament.

The head is the site where ATP binds and is hydrolyzed to adenosine diphosphate (ADP) and inorganic phosphate (Pi). ATP binding and hydrolysis cause a bend in the hinge, which results in movement. The tail region is attached to other proteins or to other kinds of cellular molecules. To promote movement, the head region of a motor protein interacts with a cytoskeletal filament, such as an actin filament (Figure b above ). When ATP binds and is hydrolyzed, the motor protein attempts to “walk” along the filament. The head of the motor protein is initially attached to a filament. To move forward, the head detaches from the filament, cocks forward, binds to the filament, and cocks backward. To picture how this works, consider the act of walking and imagine that the ground is a cytoskeletal filament, your leg is the head of the motor protein, and your hip is the hinge. To walk, you lift your leg up, you move it forward, you place it on the ground, and then you cock it backward (which propels you forward). This series of events is analogous to how a motor protein moves along a cytoskeletal filament. Motor proteins can cause three different kinds of movements: movement of cargo via the motor protein, movement of the filament, or bending of the filament.

In the example shown in Figure a, the tail region of a motor protein called kinesin is attached to a cargo, so the motor protein moves the cargo from one location to another.
Alternatively, a motor protein called myosin can remain in place and cause the filament to move (Figure b).
A third possibility is that both the motor protein and filament are restricted in their movement due to the presence of linking proteins. In this case, when motor proteins called dynein attempt to walk toward the minus end, they exert a force that causes the microtubules to bend (Figure c).


Three ways that motor proteins and cytoskeletal filaments cause movement

In certain kinds of cells, microtubules and motor proteins facilitate movement involving cell appendages called flagella and cilia (singular, flagellum and cilium). The difference between the two is that flagella are usually longer than cilia and are typically found singly or in pairs. Both flagella and cilia cause movement by generating bends that move along the length and push backwards against the surrounding fluid. A sperm cell generates bends alternatively in each direction, which begin at the head and move (propagate) toward the tip of the flagellum. (Figure a below).



Cellular movements due to the actions of flagella and cilia. 
(a) Spermatozoa (singular, spermatozoon) are sperm cells that are motile. They swim by producing repeated bends that move along a single, long flagellum. 
(b) The swimming of Chlamydomonas reinhardtii, a unicellular green algae, also involves a bending motion at the base, but the motion is precisely coordinated between two flagella. This results in swimming behavior that resembles a breaststroke. 
(c) Ciliated protozoa such as this Paramecium swim via many shorter cilia.

Alternatively, a pair of flagella may move in a synchronized manner to pull a microorganism through the water (think of a human swimmer doing the breaststroke). Certain unicellular algae swim in this manner (Figure b above). By comparison, cilia are often shorter than flagella and tend to cover all or part of the surface of a cell. Protists such as paramecia may have hundreds of adjacent cilia that beat in a coordinated fashion to propel the organism through the water (Figure c). Despite their differences in length, flagella and cilia have the same internal structure called the axoneme. The axoneme contains microtubules, the motor protein dynein, and linking proteins (Figure
below).


Structure of a eukaryotic cilium or flagellum. 
The structure of a cilium of a protist, Tetrahymena thermophila (see inset), consists of a 9 + 2 arrangement of nine outer doublet microtubules and two central microtubules. This structure is anchored to the basal body,
which has nine triplet microtubules, in which three microtubules are fused together. Note: The structure of the basal body is very similar to centrioles in animal cells.

In the cilia and flagella of most eukaryotic organisms, the microtubules form an arrangement called a 9 + 2 array. The outer nine are doublet microtubules, which are composed of a partial microtubule attached to a complete microtubule. Each of the two central microtubules consists of a single microtubule. Radial spokes project from the outer doublet microtubules toward the central pair. The microtubules in flagella and cilia emanate from basal bodies, which are anchored to the cytoplasmic side of the plasma membrane. At the basal body, the microtubules form a triplet structure. Much like the centrosome of animal cells, the basal bodies provide a site for microtubules to grow.
The movement of both flagella and cilia involves the propagation of a bend, which begins at the base of the structure and proceeds toward the tip . The bending occurs because dynein is activated to walk toward the minus end of the microtubules. However, the microtubules and dynein are not free to move relative to each other because of linking proteins. Therefore, instead of dyneins freely walking along the microtubules, they exert a force that bends the microtubules. The dyneins at the base of the flagellum or cilium are activated first, followed by dyneins that are progressively closer to the tip, and the resulting movement propels the organism.

The nucleus and endomembrane system
The nucleus is an organelle found in eukaryotic cells that contains most of the cell’s genetic material. A small amount of genetic material is also found outside the nucleus, in mitochondria and chloroplasts. The membranes that enclose the nucleus are part of a larger network of membranes called the endomembrane system. This system includes not only the nuclear envelope, which encloses the nucleus, but also the endoplasmic reticulum, Golgi apparatus, lysosomes, vacuoles, and peroxisomes. The prefix endo- (from the Greek, meaning inside) originally referred only to these organelles and internal membranes. However, we now know that the plasma membrane is
also part of this integrated membrane system (Figure below).


The nucleus and endomembrane system. 
This figure highlights the internal compartment of the nucleus (blue), the membranes of the endomembrane system (purple), and the fluid-filled interiors of the endomembrane system (pink). The nuclear envelope is part of the
endomembrane system, but the interior of the nucleus is not.


The eukaryotic nucleus contains chromosomes
The nucleus is the compartment that is enclosed by a double-membrane structure termed the nuclear envelope and houses the genetic material (Figure below).




The nucleus and nuclear envelope.

The nuclear envelope is composed of an inner membrane 
and an outer membrane that meet at the nuclear pores. 

The inner nuclear membrane is lined with lamin proteins to 

form the nuclear lamina. The interior of the nucleus 
contains chromatin, which is attached to the nuclear matrix, 


and a nucleolus, where ribosome subunits are assembled.




Nuclear pores are formed where the inner and outer nuclear membranes make contact with each other. The pores provide a passageway for the movement of molecules and macromolecules into and out of the nucleus. Although cell biologists view the nuclear envelope as part of the endomembrane system, the materials within the nucleus are not. Inside the nucleus are the chromosomes and a filamentous network of proteins called the nuclear matrix. Each chromosome is composed of genetic material, namely DNA, and many types of proteins that help to compact the chromosome to fit inside the nucleus. The complex formed between DNA and such proteins is termed chromatin. The nuclear matrix consists of two parts: the nuclear lamina, which is composed of intermediate filaments that line the inner nuclear membrane, and an internal nuclear matrix, which is connected to the lamina and fills the interior of the nucleus. The nuclear matrix serves to organize the chromosomes within the nucleus. Each chromosome is located in a distinct, nonoverlapping chromosome territory, which is visible when cells are exposed to dyes that label specific types of chromosomes

The primary function of the nucleus is the protection, organization, replication, and expression of the genetic material.. Another important function is the assembly of ribosome subunits—cellular structures involved in producing polypeptides during the process of translation. The assembly of ribosome subunits occurs in the nucleolus (plural, nucleoli), a prominent region in the nucleus of nondividing cells. A ribosome is composed of two subunits: one small and one large. Each subunit contains one or more RNA molecules and several types of proteins. Most of the RNA molecules that are components of ribosomes are made in the vicinity of the nucleolus. By comparison, the ribosomal proteins are produced in the cytosol and then imported into the nucleus through the nuclear pores. The ribosomal proteins and RNA molecules then assemble in the nucleolus to form the ribosomal subunits. Finally, the subunits exit through the nuclear pores into the cytosol, where they are needed for protein synthesis.

The endoplasmic reticulum (ER)
The endoplasmic reticulum (ER) is a network of membranes that form flattened, fluid-filled tubules, or cisternae (Figure below). The terms endoplasmic (Greek, for in the cytoplasm) and reticulum (Latin, for little net) refer to the location and shape of this organelle when viewed under a microscope. The term lumen describes the internal space of an organelle. The ER membrane encloses a single compartment called the ER lumen. There are two distinct, but continuous types of ER: rough ER and smooth ER.


Structure of the endoplasmic reticulum. 
(Left side) The endoplasmic reticulum (ER) is composed of a network of flattened tubules called cisternae that enclose a continuous ER lumen. The rough ER is studded with ribosomes, whereas the smooth ER lacks ribosomes. The rough ER is continuous with the outer nuclear membrane. (Right side) A colorized TEM of the ER. The lumen of the ER is colored yellow and the ribosomes are red.

Rough ER The outer surface of the rough endoplasmic reticulum (rough ER) is studded with ribosomes, giving it a bumpy appearance. Rough ER plays a key role in the sorting of proteins that are destined for the ER, Golgi apparatus, lysosomes, vacuoles, plasma membrane, or outside of the cell. Proteins are packaged into membrane vesicles— small spheres composed of membrane—and moved from one location in the endomembrane system to another. In conjunction with protein sorting, a second function of the rough ER is the insertion of certain newly made proteins into the ER membrane. A third important function of the rough ER is the attachment of carbohydrates to proteins and lipids. This process is called glycosylation.

Smooth ER The smooth endoplasmic reticulum (smooth ER), which lacks ribosomes, functions in diverse metabolic processes. The extensive network of smooth ER membranes provides an increased surface area for enzymes that play important metabolic roles. In liver cells, enzymes in the smooth ER detoxify many potentially harmful organic molecules, including barbiturate drugs and ethanol. These enzymes convert hydrophobic toxic molecules into more hydrophilic molecules, which are easily excreted from the body. Chronic alcohol consumption, as in alcoholics, leads to a greater amount of smooth ER in liver cells, which increases the rate of alcohol breakdown. This explains why people who consume alcohol regularly must ingest more alcohol to experience its effects. It also explains why alcoholics often have enlarged livers. The smooth ER of liver cells also plays a role in carbohydrate metabolism. The liver cells of animals store energy in the form of glycogen, which is a polymer of glucose. Glycogen granules sit very close to the smooth ER membrane. When chemical energy is needed, enzymes are activated that break down the glycogen to glucose-6-phosphate. Then, an enzyme in the smooth ER called glucose-6-phosphatase removes the phosphate group, and glucose is exported from the cell into the bloodstream. Another important function of the smooth ER in all eukaryotes is the accumulation of calcium ions (Ca2+). The smooth ER contains calcium pumps that transport Ca2+ into the ER lumen. The regulated release of Ca2+ into the cytosol is involved in many vital cellular processes, including muscle contraction in animals. Finally, enzymes in the smooth ER are critical in the synthesis and modification of lipids. For example, the smooth ER is the primary site for the synthesis of phospholipids, which are the main lipid component of eukaryotic cell membranes. In addition, enzymes in the smooth ER are necessary for certain modifications of the lipid cholesterol that are needed to produce steroid hormones such as estrogen and testosterone

The golgi apparatus directs the processing, sorting, and secretion of cellular molecules
The Golgi apparatus (also called the Golgi body, Golgi complex, or simply Golgi) was discovered by the Italian microscopist Camillo Golgi in 1898. It consists of a stack of flattened membranes, with each flattened membrane enclosing a single compartment. The Golgi compartments are named according to their orientation in the cell. The cis Golgi is near the ER membrane, the trans Golgi is closest to the plasma membrane, and the medial Golgi is found in the middle. Two models have been proposed to explain how materials move through the Golgi apparatus:

• Vesicular transport model: Materials are transported between the Golgi cisternae via membrane vesicles that bud from one compartment in the Golgi (for example, the cis Golgi) and fuse with another compartment (for example, the medial Golgi).
• Cisternal maturation model: Vesicles from the ER fuse to form a cisterna at the cis face; the cisterna that was previously at the cis face becomes a medial cisterna. This addition of a cisterna moves the other medial cisternae toward the trans face. A cisterna at the trans face is lost as a result of the export of vesicles from its surface.

Further research is needed to determine the validity of these models. The Golgi apparatus performs three overlapping functions:

(1) processing,
(2) protein sorting, and
(3) secretion.

Enzymes in the Golgi apparatus process, or modify, certain proteins and lipids. As mentioned earlier, carbohydrates can be attached to proteins and lipids in the endoplasmic reticulum. Glycosylation continues in the Golgi. For this to occur, a protein or lipid is transported via vesicles from the ER to the cis Golgi. Most of the glycosylation occurs in the medial Golgi. A second type of processing event is proteolysis, whereby enzymes called proteases make cuts in polypeptides. For example, the hormone insulin is first made as a large precursor termed proinsulin. In the Golgi apparatus, proinsulin is packaged with proteases into vesicles. The proteases cut out a portion of the proinsulin to create a smaller insulin polypeptide that is a functional hormone. This happens just prior to secretion, which is described next. The Golgi apparatus packages different types of materials (cargo) into secretory vesicles that fuse with the plasma membrane, thereby releasing their contents outside the cell. Proteins destined for secretion are synthesized into the ER, travel to the Golgi, and then are transported by vesicles to the plasma membrane. The vesicles then fuse with the plasma membrane, and the proteins are secreted to the outside of the cell. The entire route is called the secretory pathway (Figure below).


The Golgi apparatus and secretory pathway. 
The Golgi is composed of stacks of membranes that enclose distinct compartments. Transport to and from the Golgi compartments occurs via membrane vesicles. Vesicles bud from the ER and go to the Golgi, and vesicles from the
Golgi fuse with the plasma membrane to release cargo to the outside. The pathway from the ER to the Golgi to the plasma membrane is termed the secretory pathway.

In addition to secretory vesicles, the Golgi also produces vesicles that travel to other parts of the cell, such as the lysosomes.
Lysosomes are involved in the intracellular digestion of macromolecules
We now turn to another organelle of the endomembrane system, lysosomes, which are small organelles found in animal cells that break down macromolecules. Lysosomes contain many acid hydrolases, which are hydrolytic enzymes that use a molecule of water to break a covalent bond. This type of chemical reaction is called hydrolysis: The acid hydrolases in a lysosome function optimally at an acidic pH. The fluid-filled interior of a lysosome has a pH of approximately 4.8. If a lysosomal membrane breaks, releasing acid hydrolases into the cytosol, the enzymes are not very active because the cytosolic pH is neutral (approximately pH 7.2) and buffered. This prevents significant damage to the cell from lysosome breakage. Lysosomes contain many different types of acid hydrolases that break down carbohydrates, proteins, lipids, and nucleic acids. This enzymatic function enables lysosomes to break down complex materials. One function of lysosomes involves the digestion of substances that are taken up from outside the cell via a process called endocytosis. In addition, lysosomes break down intracellular molecules and macromolecules to recycle their building blocks to make new molecules and macromolecules in a process called autophagy.

Peroxisomes catalyze detoxifying reactions
Peroxisomes, discovered by Christian de Duve in 1965, are small organelles found in all eukaryotic cells. Peroxisomes consist of a single membrane that encloses a fluid-filled lumen. A typical eukaryotic cell contains several hundred of them. Peroxisomes catalyze a variety of chemical reactions, including some reactions that break down organic molecules and others that are biosynthetic. In mammals, large numbers of peroxisomes are found in liver cells, where toxic molecules accumulate and are broken down. A common by-product of the breakdown of toxins is hydrogen peroxide, H2O2. Hydrogen peroxide has the potential to damage cellular components. In the presence of metals such as iron (Fe2+), which are found naturally in living cells, H2O2 is broken down to form a hydroxide ion (OH−) and a molecule called a hydroxide free radical (·OH). The ·OH is highly reactive and can damage proteins, lipids, and
DNA. Therefore, it is beneficial for cells to break down H2O2 in an alternative manner that does not form a ·OH. Peroxisomes contain an enzyme called catalase that breaks down H2O2 to make water and oxygen gas (hence the name peroxisome). Aside from detoxification, peroxisomes usually contain enzymes involved in the metabolism of fats and amino acids. For example, plant seeds contain specialized organelles called glyoxysomes, which are
similar to peroxisomes. Seeds often store fats instead of carbohydrates. Because fats have higher energy per unit mass, a plant can make seeds that are smaller and less heavy. Glyoxysomes contain enzymes that are needed to convert fats to sugars. These enzymes become active when a seed germinates and the seedling begins to grow. A general model for peroxisome formation is shown in Figure below,  though the details may differ among animal, plant, and fungal cells. To initiate peroxisome formation, vesicles bud from the ER membrane and form a premature peroxisome. Following the import of additional proteins, the premature peroxisome becomes a mature peroxisome.
Once the mature peroxisome has formed, it may then divide to further increase the number of peroxisomes in the cell.


Formation of peroxisomes. The inset is a TEM of mature peroxisomes.

To initiate peroxisome formation, vesicles bud from the ER membrane and form a premature peroxisome. Following the import of additional proteins, the premature peroxisome becomes a mature peroxisome. Once the mature peroxisome has formed, it may then divide to further increase the number of peroxisomes in the cell.

The plasma membrane Is the interface between a cell and iIts environment
The cytoplasm of eukaryotic cells is surrounded by a plasma membrane, which is part of the endomembrane system and provides a boundary between a cell and the extracellular environment. Proteins in the plasma membrane perform many important functions that affect the activities inside the cell


Major functions of the plasma membrane. Three important roles are membrane transport, cell signaling, and cell adhesion.

Membrane Transport
First, many plasma membrane proteins are involved in membrane transport. Some of these proteins function to transport essential nutrients or ions into the cell, and others are involved in the export of substances. Due to the functioning of these protein transporters, the plasma membrane is selectively permeable; it allows only certain substances in and out. We will examine the structure and function of the plasma membrane, as well as a variety
of transporters.

Cell Signaling 
A second vital function of the plasma membrane is cell signaling. To survive and adapt to changing conditions, cells must be able to sense changes in their environment. In addition, the cells of a multicellular organism need to communicate with each other to coordinate their activities. The plasma membrane of all cells contains receptors that recognize signals—either environmental agents or molecules secreted by other cells. When a signaling molecule binds to a receptor, it activates a signal transduction pathway—a series of steps that cause the cell to respond to the signal. For example, when you eat a meal, the hormone insulin is secreted into your bloodstream. This hormone binds to receptors in the plasma membranes of your cells, which results in a cellular response that allows your cells to increase their uptake of certain molecules found in food, such as glucose.

Cell Adhesion 
A third important role of the plasma membrane in animal cells is cell adhesion. Protein-protein interactions among proteins in the plasma membranes of adjacent cells promote cell-to-cell adhesion. This phenomenon is critical for animal cells to properly interact to form a multicellular organism and allows cells to recognize each other.

Mitochondria supply cells with most of their ATP
Mitochondrion (plural, mitochondria) literally means thread granule, which is what mitochondria look like under a light microscope—either threadlike or granular-shaped. They are similar in size to bacteria. A typical cell may contain a few hundred to a few thousand mitochondria. Cells with particularly heavy energy demands, such as muscle cells, have more mitochondria than other cells. Research has shown that regular exercise increases the number and size of mitochondria in human muscle cells to meet the expanded demand for energy. A mitochondrion has an outer membrane and an inner membrane separated by a region called the intermembrane space (Figure below).


Structure of a mitochondrion. 
This figure emphasizes the membrane organization of a mitochondrion, which has an outer and inner membrane. The invaginations of the inner membrane are called cristae. The mitochondrial matrix lies inside the inner membrane. 

The inner membrane is highly invaginated (folded) to form projections called cristae. The cristae greatly increase the surface area of the inner membrane, which is the site where ATP is made. The compartment enclosed by the inner membrane is the mitochondrial matrix. The primary role of mitochondria is to make ATP. Even though mitochondria produce most of a cell’s ATP, mitochondria do not create energy. Rather, their primary function is to convert chemical energy that is stored within the covalent bonds of organic molecules into a form that can be readily used by cells. Covalent bonds in sugars, fats, and amino acids store a large amount of energy. The breakdown of these molecules into simpler molecules releases energy that is used to make ATP. Many proteins in living cells use ATP as a source of energy to carry out their functions, such as muscle contraction, the uptake of nutrients, cell division, and many other cellular processes. Mitochondria perform other functions as well. They are involved in the synthesis, modification, and breakdown of several types of cellular molecules. For example, the synthesis of certain hormones requires enzymes that are found in mitochondria. Another interesting role of mitochondria is to generate heat in specialized fat cells known as brown fat cells. Groups of brown fat cells serve as “heating pads”
that help to revive hibernating animals and protect sensitive areas of young animals from the cold.

Chloroplasts carry out photosynthesis
Chloroplasts are organelles that capture light energy and use some of that energy to synthesize organic molecules such as glucose. Chloroplasts are found in nearly all species of plants and algae. Figure below shows the structure of a typical chloroplast.



Structure of a chloroplast. 
Like a mitochondrion, a chloroplast is enclosed in a double membrane. In addition, it has an internal thylakoid membrane system that forms flattened compartments. These compartments stack on each other to form grana. The stroma is located inside the inner membrane but outside the thylakoid membrane.


Like a mitochondrion, a chloroplast contains an outer and inner membrane. An intermembrane space lies between these two membranes. A third system of membranes, the thylakoid membrane, forms many flattened, fluidfilled tubules that enclose a single, convoluted compartment called the thylakoid lumen. These tubules tend to stack on top of each other to form a structure called a granum (plural, grana). The stroma is the compartment of the chloroplast that is enclosed by the inner membrane but outside the thylakoid membrane. Chloroplasts are a specialized version of plant organelles that are more generally known as plastids. All plastids are derived from unspecialized proplastids. The various types of plastids are distinguished by their synthetic abilities and the types of pigments they contain. Chloroplasts, which carry out photosynthesis, contain the green pigment chlorophyll. The abundant number of chloroplasts in the leaves of plants gives them their green color. Chromoplasts, a second type of plastid, function in synthesizing and storing the yellow, orange, and red pigments known as carotenoids. Chromoplasts give many fruits and flowers their colors. In autumn, the chromoplasts also give many leaves their yellow, orange, and red colors. A third type of plastid, leucoplasts, typically lacks pigment molecules. An amyloplast is a leucoplast that synthesizes and stores starch. Amyloplasts are common in underground structures such as roots and tubers.

Mitochondria and chloroplasts contain their own genetic material and divide by binary fission
To fully appreciate the structure and organization of mitochondria and chloroplasts, we also need to briefly examine their genetic properties. In 1951, Yasutane Chiba exposed plant cells to Feulgen stain, a DNA-specific dye, and discovered that the chloroplasts became stained. Based on this observation, he was the first to suggest that chloroplasts contain their own DNA. Researchers in the 1970s and 1980s isolated DNA from both chloroplasts and mitochondria. These studies revealed that the DNA of these organelles resembled smaller versions of bacterial chromosomes. The chromosomes found in mitochondria and chloroplasts are referred to as the mitochondrial genome and chloroplast genome, respectively, whereas the chromosomes found in the nucleus of the cell constitute the nuclear genome. Like bacteria, the genomes of most mitochondria and chloroplasts are composed of a single circular chromosome. Compared with the nuclear genome, they are very small. For example, the amount of DNA in the human nuclear genome (about 3 billion base pairs) is about 200,000 times greater than the mitochondrial genome. In terms of genes, the human genome has approximately 22,000 different genes, whereas the human mitochondrial genome has only a few dozen. Chloroplast genomes tend to be larger than mitochondrial genomes, and they have a correspondingly greater number of genes. Depending on the particular species of plant or algae, a chloroplast genome is about 10 times larger than the mitochondrial genome of human cells. Just as the genomes of mitochondria and chloroplasts resemble bacterial genomes, the production of new mitochondria and chloroplasts bears a striking resemblance to the division of bacterial cells. Like their bacterial counterparts, mitochondria and chloroplasts
increase in number via binary fission, or splitting in two. Figure below illustrates the process for a mitochondrion.


Division of mitochondria by binary fission

The mitochondrial chromosome, which is found in a region called the nucleoid, is duplicated, and the organelle divides into two separate organelles. Mitochondrial and chloroplast divisions are needed to maintain a full complement of these organelles when cell growth occurs following cell division. In addition, environmental conditions may influence the sizes and numbers of these organelles. For example, when plants are exposed to more sunlight, the number of chloroplasts in leaf cells increases. 

Protein Sorting to Organelles
Eukaryotic cells contain a variety of membranebound organelles. Each protein that a cell makes usually functions within one cellular compartment or is secreted from the cell. How does each protein reach its appropriate destination? For example, how does a mitochondrial protein get sent to the mitochondrion rather than to a different organelle such as a lysosome? In eukaryotes, most proteins contain short stretches of amino acid sequences that direct them to their correct cellular location. These sequences are called sorting signals, or traffic signals. Each sorting signal is recognized by specific cellular components that facilitate the proper movement of that protein to its correct location. Most eukaryotic proteins begin their synthesis on ribosomes in the cytosol, using messenger RNA (mRNA) that contains the information for polypeptide synthesis (Figure below).



The cytosol provides amino acids, which are used as building blocks to make these proteins during translation. Cytosolic proteins lack any sorting signal, so they remain there. By comparison, the synthesis of proteins destined for the ER, Golgi, lysosomes, vacuoles, or secretory vesicles begins in the cytosol and then halts temporarily until the ribosome has become bound to the ER membrane. After this occurs, translation resumes and the polypeptide is synthesized into the ER. Proteins that are destined for the ER, Golgi, lysosome, vacuole, plasma membrane, or secretion are first directed to the ER. This is called cotranslational sorting because the first step in the sorting process begins while translation is occurring. Finally, the uptake of most proteins into the nucleus, mitochondria, chloroplasts, and peroxisomes occurs after the protein is completely made (that is, completely translated) in the cytosol. This is called post-translational sorting because sorting does not happen until translation is finished.

The cotranslational sorting of some proteins occurs at the endoplasmic reticulum membrane
The concept of sorting signals in proteins was first proposed by Günter Blobel in the 1970s. Blobel and colleagues discovered a sorting signal in proteins that sends them to the ER membrane, which is the first step in cotranslational sorting (Figure below).


First step in cotranslational sorting: sending proteins to the ER.

To be directed to the rough ER membrane, a polypeptide must contain a sorting signal called an ER signal sequence, which is a sequence of about 6–12 amino acids that are predominantly hydrophobic and usually located near the N-terminus. As the ribosome is making the polypeptide in the cytosol, the ER signal sequence emerges from the ribosome and is recognized by a protein-RNA complex called signal recognition particle (SRP). SRP has two functions. First, it recognizes the ER signal sequence and pauses translation. Second, SRP binds to an SRP receptor in the ER membrane, which docks the ribosome over a channel. At this stage, SRP is released and translation resumes. The growing polypeptide is threaded through the channel to cross the ER membrane. If the protein is not a membrane protein, it will be released into the lumen of the ER. In most cases, the ER signal sequence is removed by an enzyme, signal peptidase. In 1999, Blobel won the Nobel Prize in Physiology or Medicine for his discovery of sorting signals in proteins. The process shown in the Figure above illustrates another important role of protein-protein interactions—a series of interactions causes the steps of a process to occur in a specific order. Some proteins are meant to function in the ER. Such proteins contain ER retention signals in addition to the ER signal sequence.

Alternatively, other proteins that are destined for the Golgi, lysosomes, vacuoles, plasma membrane, or secretion leave the ER and are transported to their correct location. This transport process occurs via vesicles that are formed from one compartment and then move through the cytosol and fuse with another compartment. Vesicles from the ER may go to the Golgi, and then vesicles from the Golgi may go to the lysosomes, vacuoles, or plasma membrane. Sorting signals within proteins’ amino acid sequences are responsible for directing them to the correct location. 



Second step in cotranslational sorting: vesicle transport from the ER to the Golgi.

Figure above describes the second step in cotranslational sorting, vesicle transport from the ER to the Golgi. A cargo, such as protein molecules, is loaded into a developing vesicle by binding to cargo receptors in the ER membrane. Vesicle formation is facilitated by the binding of coat proteins, which, by shaping the surrounding membrane into a sphere, helps a vesicle to bud from a given membrane.

As a vesicle forms, other proteins called V-snares are incorporated into the vesicle membrane (hence the name V-snare). Many types of V-snares are known to exist. The particular V-snare that is found in a vesicle membrane depends on the type of cargo it carries. After a vesicle is released from one compartment, such as the ER, the coat is shed. The vesicle then travels through the cytosol. But how does the vesicle know where to go? The answer is that the V-snares in the vesicle membrane are recognized by T-snares in a target membrane. After V-snares recognize T-snares, the vesicle fuses with the membrane containing the T-snares. The recognition between V-snares and T-snares ensures that a vesicle carrying a specific cargo moves to the correct target membrane in the cell. Like the sorting of proteins to the ER membrane, the formation and sorting of vesicles also involves a series of protein-protein interactions that cause the steps to occur in a defined manner.

Proteins are sorted post-translationally to the nucleus, peroxisomes, mitochondria, and chloroplasts
The organization and function of the nucleus, peroxisomes, mitochondria, and chloroplasts depend on the uptake of proteins from the cytosol. Most of their proteins are synthesized in the cytosol and then taken up into their respective organelles. For example, most proteins involved in ATP synthesis are made in the cytosol and taken up into mitochondria after they have been completely synthesized. For this to occur, a protein must have the appropriate sorting signal as part of its amino acid sequence. As one example of post-translational sorting, let’s consider how a protein is directed to the mitochondrial matrix. Such a protein has a short amino acid sequence at the N-terminus called a matrix-targeting sequence. As shown in Figure below, the process of protein import into the matrix involves a series of intricate proteinprotein interactions.


Post-translational sorting of a protein to the mitochondrial matrix.

A protein destined for the mitochondrial matrix is first made in the cytosol, where proteins called chaperones keep it in an unfolded state. A receptor protein in the outer mitochondrial membrane recognizes the matrix-targeting sequence. The protein is released from the chaperone as it is transferred to a channel in the outer mitochondrial membrane. Because it is in an unfolded state, the mitochondrial protein can be threaded through this channel, and then through another channel in the inner mitochondrial membrane. These channels lie close to each other at contact sites between the outer and inner membranes. As the protein emerges in the matrix, other chaperone proteins already in the matrix continue to keep it unfolded. Eventually, the matrix-targeting sequence is cleaved, and the entire protein is threaded into the matrix. At this stage, the chaperone proteins are released, as the protein folds into its three-dimensional active structure.

1. Jerry Fodor and Massimo Piatelli-Palmarini, What Darwin Got Wrong (London: Profile Books, 2010), p. 78-79
2. https://uncommondescent.com/evolution/16037/#comment-369806



Last edited by Admin on Tue Dec 12, 2017 1:20 pm; edited 20 times in total

View user profile http://elshamah.heavenforum.com

11 Membrane Structure, Synthesis, and Transport on Sat Dec 09, 2017 4:30 pm

Admin


Admin
Membrane Structure, Synthesis, and Transport

Cell membranes are crucial to the life of the cell. The plasma membrane encloses the cell, defines its boundaries, and maintains the essential differences between the cytosol and the extracellular environment. Inside eukaryotic cells, the membranes of the nucleus, endoplasmic reticulum, Golgi apparatus, mitochondria, and other membrane-enclosed organelles maintain the characteristic differences between the contents of each organelle and the cytosol. Ion gradients across membranes, established by the activities of specialized membrane proteins, can be used to synthesize ATP, to drive the transport of selected solutes across the membrane, or, as in nerve and muscle cells, to produce and transmit electrical signals. In all cells, the plasma membrane also contains proteins that act as sensors of external signals, allowing the cell to change its behavior in response to environmental cues, including signals from other cells; these protein sensors, or receptors, transfer information—rather than molecules—across the membrane. Despite their differing functions, all biological membranes have a common general structure: each is a very thin film of lipid and protein molecules, held together mainly by noncovalent interactions. Cell membranes are dynamic, fluid structures, and most of their molecules move about in the plane of the membrane. The lipid molecules are arranged as a continuous double layer about 5 nm thick. This lipid bilayer provides the basic fluid structure of the membrane and serves as a relatively impermeable barrier to the passage of most water-soluble molecules. Most membrane proteins span the lipid bilayer and mediate nearly all of the other functions of the membrane, including the transport of specific molecules across it, and the catalysis of membrane-associated reactions such as ATP synthesis. In the plasma membrane, some transmembrane proteins serve as structural links that connect the cytoskeleton through the lipid bilayer to either the extracellular matrix or an adjacent cell, while others serve as receptors to detect and transduce chemical signals in the cell’s environment. It takes many kinds of membrane proteins to enable a cell to function and interact with its environment, and it is estimated that about 30% of the proteins encoded in an animal’s genome are membrane proteins.

Membrane Structure
Membranes are the outer boundary of individual cells and of certain organelles. Plasma membranes are the selectively permeable outermost structures of cells that separate the interior of the cell from the environment. Certain molecules are permitted to enter and exit the cell through transport across the plasma membrane. Cell membranes contain lipids and proteins that form their structure and also facilitate cellular function. For example, cell adhesion and cell signaling are cellular processes initiated by the plasma membrane. Plasma membranes also serve as attachment points for intracellular cytoskeletal proteins and for components of the extracellular matrix outside of cells.

One feature common to all cells is the presence of cellular membranes, thin sheets composed primarily of phospholipids and proteins. The current model of how cellular membranes are constructed is known as the fluid-mosaic model. The fluid-mosaic model, considers cellular membranes to consist of two layers of phospholipid molecules and that the individual phospholipid molecules are able to move about within the structure of the membrane. Many kinds of proteins and some other molecules are found among the phospholipid molecules within the membrane and on the membrane surface. The individual molecules of the membrane remain associated with one another because of the physical interaction of its molecules

with its surroundings. The phospholipid molecules of the membrane have two ends, which differ chemically. One end, which contains phosphate, is soluble in water and is therefore called hydrophilic. The other end of the phospholipid molecule consists of fatty acids, which are not soluble in water, and is called hydrophobic. In diagrams, phospholipid molecules are commonly represented as a balloon with two strings ( figure below ).
Phospholipids have a hydrophobic (water-insoluble) portion and a hydrophilic (water-soluble) portion. The hydrophilic portion contains phosphate and is represented as a balloon in many diagrams. The fatty acids are represented as two strings on the balloon.
The balloon represents the water-soluble phosphate portion of the molecule and the two strings represent the 2 fatty acids. Consequently, when phospholipid molecules are placed in water, they form a double-layered sheet, with the watersoluble
(hydrophilic) portions of the molecules facing away from each other. This is commonly referred to as a phospholipid bilayer 
If phospholipid molecules are shaken in a glass of water, the molecules automatically form double- layered membranes. It is important to understand that the membranes formed are not rigid but, rather, resemble a heavy olive oil in consistency. The component phospholipid molecules are in constant motion as they move with the surrounding water molecules and slide past one another. Other molecules found in cell membranes are cholesterol, proteins, and carbohydrates. Because cholesterol is not water-soluble, it is found in the middle of the membrane, in the hydrophobic region. It appears to play a role in stabilizing the membrane and keeping it flexible. There are many different proteins associated with the membrane. Some are found on the surface, some are partially submerged in the membrane, and others traverse the

Lipids
In most cell membranes, lipids are the most abundant type of macromolecule present. Plasma and organelle membranes contain between 40% and 80% lipid. These lipids provide both the basic structure and the framework of the membrane and also regulate its function. Three types of lipids are found in cell membranes: phospholipids, cholesterol, and glycolipids.

Phospholipids: 
The most abundant of the membrane lipids are the phospholipids. They are polar, ionic compounds that are amphipathic in nature. That is, they have both hydrophilic and hydrophobic components. The hydrophilic or polar portion is in the “head group”. Within the head group is the phosphate and an alcohol that is attached to it. The alcohol can be serine, ethanolamine, inositol, or choline. Names of phospholipids then include phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, and phosphatidylcholine. While all these phospholipids contain a molecule called glycerol, the membrane phospholipid sphingomyelin has the alcohol choline in its head group and contains sphingosine instead of glycerol.

The hydrophobic portion of the phospholipid is a long, hydrocarbon (structure of carbons and hydrogens) fatty acid tail. While the polar head groups of the outer leafl et extend outward toward the environment, the fatty acid tails extend inward. Fatty acids may be saturated, containing the maximum number of hydrogen atoms bound to carbon atoms, or unsaturated with one or more carbonto- carbon double bonds. The length of the fatty acid chains and their degree of saturation impact the membrane structure. The fatty acid chains normally undergo motions such as fl exion (bending or fl exing), rotation, and lateral movement . Whenever a carbon-to-carbon double bond exists, there is a kink in the chain, reducing some types of motions and preventing the fatty acids from packing tightly together. Phospholipids in plasma membranes of healthy cells do not migrate or fl ip-fl op from one leafl et to the other. (However, during the process of programmed cell death, enzymes catalyze the movement of phosphatidylserine from the inner leaflet to the outer leaflet

Cholesterol: 
Another major component of cell membranes is cholesterol. An amphipathic molecule, cholesterol contains a polar hydroxyl group as well as a hydrophobic steroid ring and attached hydrocarbon . Cholesterol is dispersed throughout cell membranes, intercalating between phospholipids. Its polar hydroxyl group is near the polar head groups of the phospholipids while the steroid ring and hydrocarbon tails of cholesterol are oriented parallel to those of the phospholipids. Cholesterol fits into the spaces created by the kinks of the unsaturated fatty acid tails, decreasing the ability of the fatty acids to undergo motion and therefore causing stiffening and strengthening of the membrane.

Glycolipids: 
Lipids with attached carbohydrate (sugars), glycolipids are found in cell membranes in lower concentration than phospholipids and cholesterol. The carbohydrate portion is always oriented toward the outside of the cell, projecting into the environment. Glycolipids help to form the carbohydrate coat observed on cells and are involved in cell-to-cell interactions. They are a source of blood group antigens and also can act as receptors for toxins including those from cholera and tetanus.
Biological membranes are a mosaic of lipids, proteins, and carbohydrates
The Figure below shows the biochemical organization of a membrane, which is similar in composition among all living organisms.


Fluid-mosaic model of membrane structure
The basic framework of a plasma membrane is a phospholipid bilayer. Proteins may span the membrane and may be bound on the surface to other proteins or to lipids. Proteins and lipids that have covalently bound carbohydrates
are called glycoproteins and glycolipids, respectively. The inset shows nine phospholipids and one cholesterol molecule in a bilayer, and it emphasizes the two leaflets and the polar and nonpolar regions of the bilayer.

The framework of the membrane is the phospholipid bilayer, which consists of two layers of phospholipids.  Phospholipids are amphipathic molecules. They have a hydrophobic (water-fearing) or nonpolar region, and also a hydrophilic (water-loving) or polar region. The hydrophobic tails of the lipids are found in the interior of the membrane, and the hydrophilic heads are on the surface. Biological membranes also contain proteins, and most membranes have carbohydrates attached to lipids and proteins. Overall, the membrane is considered a mosaic of lipid, protein, and carbohydrate molecules. The membrane structure illustrated in the Figure above is referred to as the fluid-mosaic model, originally proposed by S. Jonathan Singer and Garth Nicolson in 1972. The membrane exhibits properties that resemble a fluid because lipids and proteins can move relative to each other within the membrane. Half of a phospholipid bilayer is termed a leaflet. Each leaflet faces a different region. For example, the plasma membrane contains a cytosolic leaflet and an extracellular leaflet (see Figure above). With regard to lipid composition, the two leaflets of cellular membranes are asymmetrical. Certain types of lipids may be more abundant in one leaflet compared to the other. A striking asymmetry occurs with glycolipids—lipids with carbohydrate attached. These are found primarily in the extracellular leaflet. The carbohydrate portion of a glycolipid protrudes into the extracellular medium.

Proteins associate with membranes in three different ways
Although the phospholipid bilayer forms the basic foundation of cellular membranes, the protein component carries out many key functions.  Membrane proteins in the smooth ER membrane function as enzymes that break down glycogen. Membrane proteins are involved in transporting ions and molecules across membranes. Membrane proteins have three different ways of associating with a membrane (Figure below)


Types of membrane proteins.
Integral membrane proteins are of two types: transmembrane proteins and lipid-anchored proteins. Peripheral membrane proteins are noncovalently bound to the hydrophilic regions of integral membrane proteins or to the polar head groups of lipids. Inset: The protein bacteriorhodopsin contains seven transmembrane segments, depicted as cylinders, each having an α helix structure. Bacteriorhodopsin is found in halophilic (saltloving) archaea.


Proteins
While lipids form the main structure of the membrane, proteins are largely responsible for many biological functions of the membrane. For example, some membrane proteins function in transport of materials into and out of cells. Others serve as receptors for hormones or growth factors. The types of proteins within a plasma membrane vary depending on the cell type. However, all membrane proteins are associated with membrane in one of three main ways.
Transmembrane Proteins
Transmembrane proteins have one or more regions that are physically inserted into the hydrophobic interior of the phospholipid bilayer. These regions, the transmembrane segments, are stretches of nonpolar amino acids that span or traverse the membrane from one leaflet to the other. In most transmembrane proteins, each transmembrane segment is folded into an α helix structure. Such a segment is stable in a membrane because the nonpolar amino acids interact favorably with the hydrophobic lipid tails.

Membrane associations of proteins: 
While some proteins span the membrane with structures that cross from one side to the other, others are anchored to membrane lipids and still others are only peripherally associated with the cytosolic side of a plasma membrane

Lipid-anchored proteins: 
Members of the second category of membrane proteins are lipid-anchored proteins that are attached covalently to a portion of a lipid without entering the core portion of the bilayer of the membrane. Both transmembrane and lipid-anchored proteins are integral membrane proteins since they can only be removed from a membrane by disrupting the entire membrane structure.

Peripheral membrane proteins: 
Proteins in the third category are peripheral membrane proteins. These proteins are located on the cytosolic side of the membrane and are only indirectly attached to the lipid of the membrane; they bind to other proteins that are attached to the lipids. Cytoskeletal proteins, such as those involved in the spectrin membrane skeleton of erythrocytes, are examples of peripheral membrane proteins

Membrane protein functions: 
Membrane proteins enable cells to function as members of a tissue . For example, cell adhesion molecules are proteins that extend to the surface of cells and enable cell-to-cell contact . Other membrane proteins function as ion channels and transport proteins to enable molecules to enter and exit a cell. Membrane proteins that are ligand receptors enable cells to respond to hormones and other signaling molecules. The preceding examples of membrane proteins are of integral, transmembrane proteins whose structures span the bilayer. Lipid- anchored membrane proteins include the G proteins, which are named for their ability to bind to guanosine triphosphate (GTP) and participate in cell signaling in response to certain hormones .Peripheral membrane proteins include cytoskeletal proteins that attach to the membrane and regulate its shape and stabilize its structure. Some other peripheral membrane proteins are also involved in cell signaling and include enzymes attached to the inner membrane leafl et that are activated after a hormone binds to a protein receptor

Cell membranes are crucial to the life of the cell. 
The plasma membrane encloses the cell, defines its boundaries, and maintains the essential differences between the cytosol and the extracellular environment. Inside eukaryotic cells, the membranes of the nucleus, endoplasmic reticulum, Golgi apparatus, mitochondria, and other membrane-enclosed organelles maintain the characteristic differences between the contents of each organelle and the cytosol. Ion gradients across membranes, established by the activities of specialized membrane proteins, can be used to synthesize ATP, to drive the transport of selected solutes across the membrane, or, as in nerve and muscle cells, to produce and transmit electrical signals. In all cells, the plasma membrane also contains proteins that act as sensors of external signals, allowing the cell to change its behavior in response to environmental cues, including signals from other cells; these protein sensors, or receptors, transfer information—rather than molecules—across the membrane. Despite their differing functions, all biological membranes have a common general structure: each is a very thin film of lipid and protein molecules, held together mainly by noncovalent interactions. Cell membranes are dynamic, fluid structures, and most of their molecules move about in the plane of the membrane. The lipid molecules are arranged as a continuous double layer about 5 nm thick.
Membranes Are Semifluid
Though membranes are often described as fluid, it is more appropriate to say they are semifluid. In a fluid substance, molecules can move in three dimensions. By comparison, most phospholipids can rotate freely around their long axes and move laterally within the membrane leaflet (Figure below).



Semifluidity of the lipid bilayer 
(a) Spontaneous movements in the bilayer. Lipids can rotate (that is, move 360˚ ) and move laterally (for example, from left to right in the plane of the bilayer). 
(b) Flip-flop does not happen spontaneously, because the polar head group would have to pass through the hydrophobic region of the bilayer. Instead, the enzyme flippase uses ATP to flip phospholipids from one leaflet to the other.

This type of motion is considered two-dimensional, which means it occurs within the plane of the membrane. Because rotational and lateral movements keep the lipid tails within the hydrophobic interior, such movements are energetically favorable. At 37°C, a typical lipid molecule exchanges places with its neighbors about 107 times per second, and it can move several micrometers per second. At this rate, a lipid can traverse the length of a bacterial cell (approximately 1 μm) in only 1 second and the length of a typical animal cell in 10 to 20 seconds. In contrast to rotational and lateral movements, the “flip-flop” of lipids from one leaflet to the opposite leaflet does not occur spontaneously. Flip-flop is energetically unfavorable because the hydrophilic polar head of a phospholipid would have to travel through the hydrophobic interior of the membrane. How are lipids moved from one leaflet to the other? The transport of lipids between leaflets requires the action of the enzyme flippase, which requires energy input in the form of ATP (Figure b). Although most lipids diffuse rotationally and laterally within the plane of the lipid bilayer, researchers have discovered that certain types of lipids in animal cells tend to strongly associate with each other to form structures called lipid rafts. As the word raft suggests, a lipid raft is a group of lipids that float together as a unit within a larger sea of lipids. Lipid rafts have a lipid composition that differs from the surrounding membrane. For example, they usually have a high amount of cholesterol. In addition, lipid rafts may contain unique sets of lipid-anchored proteins and transmembrane proteins. The functional importance of lipid rafts is the subject of a large amount of current research. Lipid rafts may play an important role in endocytosis  and cell signaling. Depending on the cell type, 10–70% of membrane proteins may be restricted in their movement. Transmembrane proteins may be bound to components of the cytoskeleton, which restricts the proteins from moving (Figure below), or may be attached to molecules that are outside the cell, such as the interconnected network of proteins that forms the
extracellular matrix of animal cells.


Attachment of transmembrane proteins to the cytoskeleton and extracellular matrix of an animal cell. 
Some transmembrane proteins have regions that extend into the cytosol and are anchored to large cytoskeletal filaments via linker proteins. Being bound to these large filaments restricts the movement of these proteins. Similarly, some transmembrane proteins are bound to large, immobile fibers in the extracellular matrix, which restricts their movements.

Synthesis of Membrane Components in Eukaryotic Cells
Cellular membranes are composed of lipids, proteins, and carbohydrates. Most of the membrane components of eukaryotic cells are made at the endoplasmic reticulum (ER).  We will  examine the process by which transmembrane proteins are inserted into the ER membrane and explore how carbohydrates are attached to some proteins. In eukaryotic cells, the cytosol and endomembrane system work together to synthesize most lipids. This process occurs at the cytosolic leaflet of the smooth ER membrane. Figure below shows a simplified pathway for the synthesis of phospholipids.


A simplified pathway for the synthesis of membrane phospholipids at the ER membrane. 
Note: Phosphate is abbreviated P when it is attached to an organic molecule and Pi when it is unattached. The subscript i refers to the inorganic form of phosphate.

The building blocks for a phospholipid are two fatty acids, each with a long tail, one glycerol molecule, one phosphate, and a polar head group. These building blocks are made via enzymes in the cytosol, or they are taken into
cells from food. To begin the process of phospholipid synthesis, the fatty acids are activated by attachment to an organic molecule called coenzyme A (CoA). This activation promotes the bonding of the two fatty acids to a glycerol-phosphate molecule, and the resulting molecule is inserted into the cytosolic leaflet of the ER membrane. The phosphate is removed from glycerol, and then a polar molecule already linked to phosphate is attached to glycerol. In the example shown in Figure below, the polar head group contains choline, but many other types of head groups are possible.

Phospholipids are initially inserted into the cytosolic leaflet. Flippases in the ER membrane transfer some of the newly made lipids to the other leaflet so similar amounts of lipids are found in both leaflets. The lipids made in the ER membrane are transferred to other membranes in the cell by a variety of mechanisms. Phospholipids in the ER can diffuse laterally to the nuclear envelope. In addition, lipids are transported via vesicles to the Golgi, lysosomes, vacuoles, or plasma membrane. A third mode of lipid transfer involves lipid exchange proteins, which extract a lipid from one membrane, diffuse through the cell, and insert the lipid into another membrane. Such transfer can occur between any two membranes, even between the endomembrane system and semiautonomous organelles. For example, lipid exchange proteins transfer lipids between the ER and mitochondria. In addition, chloroplasts and mitochondria synthesize certain types of lipids that are transferred from these organelles to other cellular membranes via lipid exchange proteins.

View user profile http://elshamah.heavenforum.com

Sponsored content


View previous topic View next topic Back to top  Message [Page 1 of 1]

Permissions in this forum:
You cannot reply to topics in this forum